Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8448227.1

Orthogroup ID

OG0001202

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1638

Gene Structure 1637 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8448227.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1437 bp

ctggtccaaattgtgaatcctgcgaggggctttgggaaagatgtacaggaagcaaagaacgagacatactcaactgccaaaaggatcaatgaggtttatggttctcctaattatgagccagttattctgattgattgtcctgtttctcatcaagagaaatcagcctattatgctgtggccgaatgctgtatagtgaatgccgtaagggatggaatgaacttagttccttacaaatatattgtttgcaggcagggaactccagatatgaatgaagctttaggcttaacagaagattctcctcggacgagcatgctcgttgtgtctgaatttattggttgctcaccttctttaagtggagcaatcagggttaacccttgggatattgatgctgtggctgatgctttgaacttggctatcaccatgtcgaactccgagaagcagttacgtcatgagaaacactatcgttatgtcagttctcatgatgtggcatattgggcacgaagcttttcacaggatttggatagagcatgtcgagatcattatagtaaaaggtgctggggaattggtttgggcttgaggttcagagttgtttccctttctccgaattttaggaagctgtctgtagaccacattgtctcggcttataaaagaacaactagaagggcaatattcttggactatgatggaactgtcattccccaaacttcgattatcaagtccccaagcccggaagtcctttctatgatgaattccctgtgcaaagatccaaagaacactgtttttattgttagtgggaggagtaggacttctctgggcgattggtttgcctcatgtgagaagctggggattgctgctgagcatggctacttcttaaggtggggtagtacttccaagtgggaaaccagtctagtctctgctgaccttgattggaaagagattgtggagcctgtgatgagattatatacggaggcaacagacggctccaacatagaaagtaaagagagtgctttggtatggcatcatcaagatgcagaccctgactttggatcctgtcaggccaaggagttgctggatcatctggaaaatgtgcttgctaatgaaccagctctagtcaagagaggccagcatatcgttgaggttaagccgcagggagtaagcaaaggattggttgctgagaaggttcttttgagaatggtcaatgatgggaagccaccagattttgtgatgtgcattggggacgacagatctgatgaagacatgtttgaaagcatattaagcacagttgctagtcctttattgccttcgcctcctgagatatttgcttgcacggttggaagaaagccaagtaaggccaagtactatctcgatgatgcaattgatgttgtgaagttacttcaaggccttgctactgcttcaaaccccaagcccaggaatcta

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005975 GO:0005984 GO:0005991 GO:0005992 GO:0006793 GO:0006796 GO:0006950 GO:0008150 GO:0008152 GO:0009058 GO:0009311 GO:0009312 GO:0009987 GO:0016051 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0033554 GO:0034637 GO:0042578 GO:0044237 GO:0044238 GO:0044249 GO:0044262 GO:0044424 GO:0044464 GO:0046351 GO:0050896 GO:0051716 GO:0070413 GO:0071704 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00500 ko01100 map00500 map01100

Pfam Domains

Protein Families

Glyco_transf_20 Trehalose_PPase

Protein Analysis

479

Amino Acids

53.33

Weight (kDa)

6.05

Isoelectric Point (pI)

48.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001202)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G23870 AT1G60140 AT1G60140 AT1G60140 AT1G60140 AT1G60140 AT1G60140 AT1G70290 AT1G70290
fragaria_vesca	FvH4_4g34800 FvH4_4g34800 FvH4_4g34800 FvH4_4g34800 FvH4_4g34800 FvH4_4g34800 FvH4_4g34800 FvH4_5g05100 FvH4_5g05100 FvH4_5g05100 FvH4_5g05100 FvH4_5g05100 FvH4_5g05100 FvH4_5g05100 FvH4_5g05100 FvH4_5g05100
malus_domestica	MD00G1171800.v1.1 MD13G1089600.v1.1 MD14G1183700.v1.1 MD16G1089800.v1.1
prunus_persica	Prupe.1G256200_v2.0.a1 Prupe.5G176400_v2.0.a1
pyrus_communis	pycom06g15770 pycom13g07810 pycom14g15280 pycom16g07690
rosa_chinensis	RchiOBHm_Chr4g0444141 RchiOBHm_Chr7g0193901
rosa_laevigata	RLG00000004229 RLG00000004235 RLG00000005852
rosa_multiflora	Rmu_co8448227.1_g000001 Rmu_sc0012638.1_g000011
rosa_roxburghii	Rroxscaffold_3G00261720 Rroxscaffold_5G00384730
rosa_rugosa	Rorug04G0350400 Rorug07G0012500 Rorug07G0012600 Rorug07G0012700
rosa_samantha	Rh4AG411000 Rh4BG422400 Rh4CG436800 Rh4DG417700 Rh7BG140000 Rh7CG143700
rosa_wichuraiana	Rw4G035310 Rw7G011900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	645
AasI	GACNNNNNNGTC	1 cut(s)	632
AccI	GTMKAC	1 cut(s)	624
AciI	CCGC	1 cut(s)	1145
AclWI	GGATC	5 cut(s)	92, 758, 1041, 1054, 1080
AcoI	YGGCCR	1 cut(s)	177
AcsI	RAATTY	3 cut(s)	326, 604, 748
AfaI	GTAC	3 cut(s)	45, 886, 1358
AfiI	CCNNNNNNNGG	4 cut(s)	26, 727, 1043, 1428
AflII	CTTAAG	1 cut(s)	871
AflIII	ACRYGT	1 cut(s)	1257
AgsI	TTSAA	4 cut(s)	406, 1265, 1397, 1416
AjnI	CCWGG	1 cut(s)	1427
AloI	GAACNNNNNNTCC	2 cut(s)	679, 711
AluBI	AGCT	5 cut(s)	275, 504, 616, 841, 1106
AluI	AGCT	5 cut(s)	275, 504, 616, 841, 1106
Alw26I	GTCTC	3 cut(s)	56, 640, 916
AlwI	GGATC	5 cut(s)	92, 758, 1041, 1054, 1080
AlwNI	CAGNNNCTG	1 cut(s)	1037
AoxI	GGCC	5 cut(s)	177, 1056, 1120, 1350, 1399
ApeKI	GCWGC	1 cut(s)	851
ApoI	RAATTY	3 cut(s)	326, 604, 748
ArsI	GACNNNNNNTTYG	2 cut(s)	1025, 1057
Asp700I	GAANNNNTTC	1 cut(s)	505
AspS9I	GGNCC	1 cut(s)	4
AsuC2I	CCSGG	1 cut(s)	728
AsuHPI	GGTGA	2 cut(s)	333, 409
AvaII	GGWCC	1 cut(s)	4
BaeGI	GKGCMC	1 cut(s)	499
BamHI	GGATCC	1 cut(s)	1046
BbsI	GAAGAC	1 cut(s)	1260
BbvI	GCAGC	1 cut(s)	838
BccI	CCATC	3 cut(s)	203, 677, 1196
BceAI	ACGGC	2 cut(s)	185, 994
BcgI	CGANNNNNNTGC	2 cut(s)	806, 840
BciT130I	CCWGG	1 cut(s)	1429
BcnI	CCSGG	1 cut(s)	728
BcoDI	GTCTC	3 cut(s)	56, 640, 916
BfaI	CTAG	4 cut(s)	657, 908, 1109, 1287
BfmI	CTRYAG	1 cut(s)	621
BfrI	CTTAAG	1 cut(s)	871
BglII	AGATCT	1 cut(s)	1244
BisI	GCNGC	2 cut(s)	852, 1145
BlpI	GCTNAGC	1 cut(s)	855
BlsI	GCNGC	2 cut(s)	853, 1146
BmcAI	AGTACT	2 cut(s)	886, 1358
Bme1390I	CCNGG	2 cut(s)	728, 1429
Bme18I	GGWCC	1 cut(s)	4
BmgT120I	GGNCC	1 cut(s)	4
BmiI	GGNNCC	3 cut(s)	945, 982, 1048
BmrFI	CCNGG	2 cut(s)	728, 1429
BmsI	GCATC	5 cut(s)	376, 388, 1018, 1027, 1360
BpiI	GAAGAC	1 cut(s)	1260
BplI	GAGNNNNNCTC	2 cut(s)	53, 85
BpmI	CTGGAG	1 cut(s)	243
Bpu1102I	GCTNAGC	1 cut(s)	855
BpuEI	CTTGAG	1 cut(s)	595
BpuMI	CCSGG	1 cut(s)	728
BsaJI	CCNNGG	4 cut(s)	299, 374, 1059, 1427
Bsc4I	CCNNNNNNNGG	4 cut(s)	26, 727, 1043, 1428
Bse1I	ACTGG	2 cut(s)	119, 903
BseBI	CCWGG	1 cut(s)	1429
BseDI	CCNNGG	4 cut(s)	299, 374, 1059, 1427
BseGI	GGATG	1 cut(s)	214
BseLI	CCNNNNNNNGG	4 cut(s)	26, 727, 1043, 1428
BseMII	CTCAG	3 cut(s)	846, 1164, 1302
BseNI	ACTGG	2 cut(s)	119, 903
BseRI	GAGGAG	2 cut(s)	288, 811
BseSI	GKGCMC	1 cut(s)	499
BseXI	GCAGC	1 cut(s)	838
BseYI	CCCAGC	2 cut(s)	555, 841
BshFI	GGCC	5 cut(s)	179, 1058, 1122, 1352, 1401
BsiSI	CCGG	1 cut(s)	728
BslFI	GGGAC	2 cut(s)	703, 1250
BslI	CCNNNNNNNGG	4 cut(s)	26, 727, 1043, 1428
BsmAI	GTCTC	3 cut(s)	56, 640, 916
BsmFI	GGGAC	2 cut(s)	703, 1250
BsmI	GAATGC	2 cut(s)	188, 202
BsnI	GGCC	5 cut(s)	179, 1058, 1122, 1352, 1401
Bsp1286I	GDGCHC	1 cut(s)	499
Bsp1407I	TGTACA	1 cut(s)	43
Bsp143I	GATC	6 cut(s)	84, 535, 763, 1046, 1072, 1244
Bsp1720I	GCTNAGC	1 cut(s)	855
BspACI	CCGC	1 cut(s)	1145
BspANI	GGCC	5 cut(s)	179, 1058, 1122, 1352, 1401
BspCNI	CTCAG	3 cut(s)	847, 1165, 1303
BspHI	TCATGA	2 cut(s)	448, 478
BspLI	GGNNCC	3 cut(s)	945, 982, 1048
BspPI	GGATC	5 cut(s)	92, 758, 1041, 1054, 1080
BspTI	CTTAAG	1 cut(s)	871
BsrGI	TGTACA	1 cut(s)	43
BsrI	ACTGG	2 cut(s)	119, 903
BssECI	CCNNGG	4 cut(s)	299, 374, 1059, 1427
BssMI	GATC	6 cut(s)	84, 535, 763, 1046, 1072, 1244
BssT1I	CCWWGG	2 cut(s)	374, 1059
Bst2UI	CCWGG	1 cut(s)	1429
Bst4CI	ACNGT	4 cut(s)	691, 778, 1282, 1330
BstAFI	CTTAAG	1 cut(s)	871
BstAUI	TGTACA	1 cut(s)	43
BstC8I	GCNNGC	5 cut(s)	248, 311, 1092, 1124, 1324
BstDEI	CTNAG	4 cut(s)	220, 855, 1173, 1311
BstF5I	GGATG	1 cut(s)	214
BstKTI	GATC	6 cut(s)	87, 538, 766, 1049, 1075, 1247
BstMAI	GTCTC	3 cut(s)	56, 640, 916
BstMBI	GATC	6 cut(s)	84, 535, 763, 1046, 1072, 1244
BstMWI	GCNNNNNNNGC	3 cut(s)	170, 494, 1275
BstNI	CCWGG	1 cut(s)	1429
BstNSI	RCATGY	3 cut(s)	313, 531, 1261
BstSCI	CCNGG	2 cut(s)	726, 1427
BstSFI	CTRYAG	1 cut(s)	621
BstSLI	GKGCMC	1 cut(s)	499
BstV1I	GCAGC	1 cut(s)	838
BstV2I	GAAGAC	1 cut(s)	1260
BstX2I	RGATCY	3 cut(s)	763, 1046, 1244
BstYI	RGATCY	3 cut(s)	763, 1046, 1244
BsuRI	GGCC	5 cut(s)	179, 1058, 1122, 1352, 1401
BtsCI	GGATG	1 cut(s)	214
BtsIMutI	CAGTG	1 cut(s)	774
Cac8I	GCNNGC	5 cut(s)	248, 311, 1092, 1124, 1324
CaiI	CAGNNNCTG	1 cut(s)	1037
CciI	TCATGA	2 cut(s)	448, 478
Cfr13I	GGNCC	1 cut(s)	4
Csp6I	GTAC	3 cut(s)	44, 885, 1357
CviAII	CATG	8 cut(s)	310, 421, 449, 479, 528, 831, 860, 1258
CviQI	GTAC	3 cut(s)	44, 885, 1357
DdeI	CTNAG	4 cut(s)	220, 855, 1173, 1311
DpnI	GATC	6 cut(s)	86, 537, 765, 1048, 1074, 1246
DpnII	GATC	6 cut(s)	84, 535, 763, 1046, 1072, 1244
DrdI	GACNNNNNNGTC	1 cut(s)	632
DseDI	GACNNNNNNGTC	1 cut(s)	632
EaeI	YGGCCR	1 cut(s)	177
Eco130I	CCWWGG	2 cut(s)	374, 1059
Eco147I	AGGCCT	1 cut(s)	1401
Eco47I	GGWCC	1 cut(s)	4
EcoRI	GAATTC	1 cut(s)	748
EcoRII	CCWGG	1 cut(s)	1427
EcoT14I	CCWWGG	2 cut(s)	374, 1059
ErhI	CCWWGG	2 cut(s)	374, 1059
FaeI	CATG	8 cut(s)	313, 424, 452, 482, 531, 834, 863, 1261
FaqI	GGGAC	2 cut(s)	703, 1250
FatI	CATG	8 cut(s)	309, 420, 448, 478, 527, 830, 859, 1257
FblI	GTMKAC	1 cut(s)	624
Fnu4HI	GCNGC	2 cut(s)	852, 1145
FokI	GGATG	1 cut(s)	221
Fsp4HI	GCNGC	2 cut(s)	852, 1145
FspBI	CTAG	4 cut(s)	657, 908, 1109, 1287
GluI	GCNGC	2 cut(s)	852, 1145
GsaI	CCCAGC	2 cut(s)	559, 845
GsuI	CTGGAG	1 cut(s)	243
HaeIII	GGCC	5 cut(s)	179, 1058, 1122, 1352, 1401
HapII	CCGG	1 cut(s)	728
Hin1II	CATG	8 cut(s)	313, 424, 452, 482, 531, 834, 863, 1261
HincII	GTYRAC	1 cut(s)	370
HindII	GTYRAC	1 cut(s)	370
HindIII	AAGCTT	2 cut(s)	273, 502
HinfI	GANTC	3 cut(s)	16, 293, 1432
HpaI	GTTAAC	1 cut(s)	370
HpaII	CCGG	1 cut(s)	728
HphI	GGTGA	2 cut(s)	333, 409
Hpy166II	GTNNAC	2 cut(s)	370, 625
Hpy188I	TCNGA	7 cut(s)	129, 303, 325, 433, 584, 603, 1249
Hpy8I	GTNNAC	2 cut(s)	370, 625
HpyAV	CCTTC	4 cut(s)	354, 654, 1171, 1311
HpyCH4III	ACNGT	4 cut(s)	691, 778, 1282, 1330
HpyCH4IV	ACGT	1 cut(s)	445
HpyCH4V	TGCA	6 cut(s)	246, 759, 1031, 1230, 1326, 1373
HpyF10VI	GCNNNNNNNGC	3 cut(s)	170, 494, 1275
HpyF3I	CTNAG	4 cut(s)	220, 855, 1173, 1311
HpySE526I	ACGT	1 cut(s)	445
Hsp92II	CATG	8 cut(s)	313, 424, 452, 482, 531, 834, 863, 1261
KspAI	GTTAAC	1 cut(s)	370
Kzo9I	GATC	6 cut(s)	84, 535, 763, 1046, 1072, 1244
LmnI	GCTCC	3 cut(s)	356, 943, 986
Lsp1109I	GCAGC	1 cut(s)	838
LweI	GCATC	5 cut(s)	376, 388, 1018, 1027, 1360
MaeI	CTAG	4 cut(s)	657, 908, 1109, 1287
MaeII	ACGT	1 cut(s)	445
MaeIII	GTNAC	2 cut(s)	441, 1389
MalI	GATC	6 cut(s)	86, 537, 765, 1048, 1074, 1246
MboI	GATC	6 cut(s)	84, 535, 763, 1046, 1072, 1244
MboII	GAAGA	3 cut(s)	302, 1265, 1347
MfeI	CAATTG	1 cut(s)	1374
MflI	RGATCY	3 cut(s)	763, 1046, 1244
MhlI	GDGCHC	1 cut(s)	499
MluCI	AATT	7 cut(s)	9, 109, 326, 561, 604, 748, 1374
MmeI	TCCRAC	2 cut(s)	1008, 1312
MroXI	GAANNNNTTC	1 cut(s)	505
MseI	TTAA	6 cut(s)	284, 350, 369, 872, 1140, 1274
MslI	CAYNNNNRTG	1 cut(s)	1026
MspCI	CTTAAG	1 cut(s)	871
MspI	CCGG	1 cut(s)	728
MspR9I	CCNGG	2 cut(s)	728, 1429
MunI	CAATTG	1 cut(s)	1374
Mva1269I	GAATGC	2 cut(s)	188, 202
MvaI	CCWGG	1 cut(s)	1429
MwoI	GCNNNNNNNGC	3 cut(s)	170, 494, 1275
NciI	CCSGG	1 cut(s)	728
NdeII	GATC	6 cut(s)	84, 535, 763, 1046, 1072, 1244
NlaIII	CATG	8 cut(s)	313, 424, 452, 482, 531, 834, 863, 1261
NlaIV	GGNNCC	3 cut(s)	945, 982, 1048
NmeAIII	GCCGAG	1 cut(s)	617
NspI	RCATGY	3 cut(s)	313, 531, 1261
PaeI	GCATGC	1 cut(s)	313
PagI	TCATGA	2 cut(s)	448, 478
PceI	AGGCCT	1 cut(s)	1401
PciI	ACATGT	1 cut(s)	1257
PctI	GAATGC	2 cut(s)	188, 202
PdmI	GAANNNNTTC	1 cut(s)	505
PfeI	GAWTC	3 cut(s)	16, 293, 1432
PkrI	GCNGC	2 cut(s)	853, 1146
PscI	ACATGT	1 cut(s)	1257
PsiI	TTATAA	1 cut(s)	645
Psp6I	CCWGG	1 cut(s)	1427
PspFI	CCCAGC	2 cut(s)	555, 841
PspGI	CCWGG	1 cut(s)	1427
PspN4I	GGNNCC	3 cut(s)	945, 982, 1048
PspPI	GGNCC	1 cut(s)	4
PsrI	GAACNNNNNNTAC	2 cut(s)	50, 82
PstNI	CAGNNNCTG	1 cut(s)	1037
PsuI	RGATCY	3 cut(s)	763, 1046, 1244
RsaI	GTAC	3 cut(s)	45, 886, 1358
RsaNI	GTAC	3 cut(s)	44, 885, 1357
RseI	CAYNNNNRTG	1 cut(s)	1026
SaqAI	TTAA	6 cut(s)	284, 350, 369, 872, 1140, 1274
SatI	GCNGC	2 cut(s)	852, 1145
Sau3AI	GATC	6 cut(s)	84, 535, 763, 1046, 1072, 1244
Sau96I	GGNCC	1 cut(s)	4
ScaI	AGTACT	2 cut(s)	886, 1358
ScrFI	CCNGG	2 cut(s)	728, 1429
SduI	GDGCHC	1 cut(s)	499
SfaNI	GCATC	5 cut(s)	376, 388, 1018, 1027, 1360
SfcI	CTRYAG	1 cut(s)	621
SinI	GGWCC	1 cut(s)	4
SmiMI	CAYNNNNRTG	1 cut(s)	1026
SmlI	CTYRAG	2 cut(s)	574, 871
SmoI	CTYRAG	2 cut(s)	574, 871
SphI	GCATGC	1 cut(s)	313
Sse9I	AATT	7 cut(s)	9, 109, 326, 561, 604, 748, 1374
SseBI	AGGCCT	1 cut(s)	1401
SsiI	CCGC	1 cut(s)	1145
SspI	AATATT	1 cut(s)	669
SspMI	CTAG	4 cut(s)	657, 908, 1109, 1287
StuI	AGGCCT	1 cut(s)	1401
StyD4I	CCNGG	2 cut(s)	726, 1427
StyI	CCWWGG	2 cut(s)	374, 1059
TaaI	ACNGT	4 cut(s)	691, 778, 1282, 1330
TaiI	ACGT	1 cut(s)	448
TaqI	TCGA	4 cut(s)	425, 532, 707, 1365
TasI	AATT	7 cut(s)	9, 109, 326, 561, 604, 748, 1374
TatI	WGTACW	3 cut(s)	43, 884, 1356
TauI	GCSGC	1 cut(s)	1147
TfiI	GAWTC	3 cut(s)	16, 293, 1432
Tru1I	TTAA	6 cut(s)	284, 350, 369, 872, 1140, 1274
Tru9I	TTAA	6 cut(s)	284, 350, 369, 872, 1140, 1274
TscAI	CASTG	1 cut(s)	781
TseI	GCWGC	1 cut(s)	851
TspDTI	ATGAA	6 cut(s)	230, 281, 285, 761, 1113, 1266
TspGWI	ACGGA	1 cut(s)	980
TspRI	CASTG	1 cut(s)	781
Vha464I	CTTAAG	1 cut(s)	871
VpaK11BI	GGWCC	1 cut(s)	4
XapI	RAATTY	3 cut(s)	326, 604, 748
XceI	RCATGY	3 cut(s)	313, 531, 1261
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1066
XmiI	GTMKAC	1 cut(s)	624
XmnI	GAANNNNTTC	1 cut(s)	505
XspI	CTAG	4 cut(s)	657, 908, 1109, 1287
ZrmI	AGTACT	2 cut(s)	886, 1358

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.