Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8469755.1

Orthogroup ID

OG0001751

Physical Location & Seq

Genomic Coordinates Forward (+)

505 .. 1985

Gene Structure 1481 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8469755.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 810 bp

atgtttgtaacatcaattgatgattttgatgagatggggtattcactcagtagattgactgtagaatctgactattttgatgatgggagtaccaacaacggatcagttgagagcattgatggacccaacaaacagtttgatagtttagaccatgaagtagctcagctcacaaagctgagatcagcacccaatgagaggcttaggcaagtcggaccggggaggcggggccgacctgtttcgacagtgaagatgctggaagggagagaaggtaattattcaggaagggggaggttctcttctgcagattgttgtcatgtttcaggtagatacttgccgctgaatggtccttggctcgttgaccagatgcctagccgagcatatgtctcgcagttttcagcagatggatctctttttgttgcggggtttcagggtagccacattagaatatacaatgtggataaagggtggaaagtccagaaggacattcatgccaagagtatgagatggacagtgactgatacatctctttccccagatcaacgccatcttgtctatgcgagcatgtcacctattgttcatatagttaatgtgggatctgctgaaacagaatctcgtgctaatataatggaaatccatgagggtttggatttttcttctgctgatgatggagtatactcctttggtattttctccataaaattttcaacagatggacgtgaagttgttgctggaagtagtgatgggtccatatatgtttatgatcttgaaactaataagctctcccttcgaattttggctcacacggtatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

269

Amino Acids

29.75

Weight (kDa)

5.47

Isoelectric Point (pI)

39.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001751)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G03020 AT4G03020 AT4G03020
fragaria_vesca	FvH4_2g24350 FvH4_2g24350 FvH4_2g24350 FvH4_4g16870 FvH4_4g16870
malus_domestica	MD03G1273100.v1.1 MD11G1294100.v1.1 MD13G1176000.v1.1 MD16G1177700.v1.1
prunus_persica	Prupe.1G145000_v2.0.a1 Prupe.1G145000_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1 Prupe.8G249600_v2.0.a1
pyrus_communis	pycom03g21760 pycom11g26020 pycom13g15170
rosa_chinensis	RchiOBHm_Chr4g0420461 RchiOBHm_Chr6g0292221
rosa_laevigata	RLG00000007761 RLG00000012052
rosa_multiflora	Rmu_co8469755.1_g000001 Rmu_sc0002248.1_g000028 Rmu_sc0002993.1_g000006 Rmu_sc0017106.1_g000005
rosa_roxburghii	Rroxscaffold_5G00363080 Rroxscaffold_7G00175340
rosa_rugosa	Rorug04G0163900 Rorug06G0224500 Rorug06G0224500
rosa_samantha	Rh4CG239900 Rh6AG337600 Rh6BG344900 Rh6CG352000
rosa_wichuraiana	Rw4G019470 Rw6G029400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	672
AciI	CCGC	3 cut(s)	223, 335, 419
AclWI	GGATC	3 cut(s)	109, 412, 601
AcsI	RAATTY	2 cut(s)	698, 789
AfaI	GTAC	1 cut(s)	91
AfiI	CCNNNNNNNGG	2 cut(s)	195, 341
AgsI	TTSAA	2 cut(s)	705, 767
AjiI	CACGTC	1 cut(s)	716
AluBI	AGCT	4 cut(s)	161, 166, 175, 778
AluI	AGCT	4 cut(s)	161, 166, 175, 778
Alw26I	GTCTC	1 cut(s)	388
AlwI	GGATC	3 cut(s)	109, 412, 601
AlwNI	CAGNNNCTG	1 cut(s)	515
AoxI	GGCC	1 cut(s)	226
ApoI	RAATTY	2 cut(s)	698, 789
AspS9I	GGNCC	5 cut(s)	122, 212, 226, 344, 744
AsuC2I	CCSGG	1 cut(s)	216
AsuHPI	GGTGA	1 cut(s)	558
AsuII	TTCGAA	1 cut(s)	787
AvaII	GGWCC	4 cut(s)	122, 212, 344, 744
BauI	CACGAG	1 cut(s)	612
BccI	CCATC	9 cut(s)	28, 77, 113, 395, 498, 552, 659, 704, 734
BcgI	CGANNNNNNTGC	2 cut(s)	366, 400
BcnI	CCSGG	1 cut(s)	216
BcoDI	GTCTC	1 cut(s)	388
BfaI	CTAG	1 cut(s)	369
BfmI	CTRYAG	2 cut(s)	60, 300
BisI	GCNGC	1 cut(s)	335
BlpI	GCTNAGC	1 cut(s)	162
BlsI	GCNGC	1 cut(s)	336
Bme1390I	CCNGG	1 cut(s)	216
Bme18I	GGWCC	4 cut(s)	122, 212, 344, 744
BmgBI	CACGTC	1 cut(s)	716
BmgT120I	GGNCC	5 cut(s)	122, 212, 226, 344, 744
BmiI	GGNNCC	3 cut(s)	124, 227, 745
BmrFI	CCNGG	1 cut(s)	216
BmsI	GCATC	2 cut(s)	240, 354
Bpu10I	CCTNAGC	1 cut(s)	200
Bpu1102I	GCTNAGC	1 cut(s)	162
Bpu14I	TTCGAA	1 cut(s)	787
BpuMI	CCSGG	1 cut(s)	216
BsaJI	CCNNGG	2 cut(s)	215, 347
BsaXI	ACNNNNNCTCC	2 cut(s)	253, 283
Bsc4I	CCNNNNNNNGG	2 cut(s)	195, 341
BseDI	CCNNGG	2 cut(s)	215, 347
BseLI	CCNNNNNNNGG	2 cut(s)	195, 341
BseMII	CTCAG	3 cut(s)	61, 167, 176
BshFI	GGCC	1 cut(s)	228
BsiSI	CCGG	1 cut(s)	215
BslI	CCNNNNNNNGG	2 cut(s)	195, 341
BsmAI	GTCTC	1 cut(s)	388
BsnI	GGCC	1 cut(s)	228
Bsp119I	TTCGAA	1 cut(s)	787
Bsp143I	GATC	6 cut(s)	101, 179, 404, 535, 593, 760
Bsp1720I	GCTNAGC	1 cut(s)	162
BspACI	CCGC	3 cut(s)	223, 335, 419
BspANI	GGCC	1 cut(s)	228
BspCNI	CTCAG	3 cut(s)	60, 168, 175
BspLI	GGNNCC	3 cut(s)	124, 227, 745
BspMAI	CTGCAG	1 cut(s)	304
BspPI	GGATC	3 cut(s)	109, 412, 601
BspT104I	TTCGAA	1 cut(s)	787
BssECI	CCNNGG	2 cut(s)	215, 347
BssMI	GATC	6 cut(s)	101, 179, 404, 535, 593, 760
BssNAI	GTATAC	1 cut(s)	673
BssSI	CACGAG	1 cut(s)	612
BssT1I	CCWWGG	1 cut(s)	347
Bst1107I	GTATAC	1 cut(s)	673
Bst2BI	CACGAG	1 cut(s)	612
Bst4CI	ACNGT	5 cut(s)	61, 135, 244, 511, 805
Bst6I	CTCTTC	1 cut(s)	301
BstBI	TTCGAA	1 cut(s)	787
BstC8I	GCNNGC	1 cut(s)	559
BstDEI	CTNAG	4 cut(s)	47, 162, 176, 200
BstKTI	GATC	6 cut(s)	104, 182, 407, 538, 596, 763
BstMAI	GTCTC	1 cut(s)	388
BstMBI	GATC	6 cut(s)	101, 179, 404, 535, 593, 760
BstMWI	GCNNNNNNNGC	1 cut(s)	172
BstNSI	RCATGY	1 cut(s)	565
BstSCI	CCNGG	1 cut(s)	214
BstSFI	CTRYAG	2 cut(s)	60, 300
BstX2I	RGATCY	2 cut(s)	404, 593
BstYI	RGATCY	2 cut(s)	404, 593
BstZ17I	GTATAC	1 cut(s)	673
BsuRI	GGCC	1 cut(s)	228
BtrI	CACGTC	1 cut(s)	716
BtsIMutI	CAGTG	2 cut(s)	249, 516
Cac8I	GCNNGC	1 cut(s)	559
CaiI	CAGNNNCTG	1 cut(s)	515
Cfr13I	GGNCC	5 cut(s)	122, 212, 226, 344, 744
CpoI	CGGWCCG	1 cut(s)	212
Csp6I	GTAC	1 cut(s)	90
CspI	CGGWCCG	1 cut(s)	212
CviAII	CATG	5 cut(s)	152, 314, 488, 562, 635
CviQI	GTAC	1 cut(s)	90
DdeI	CTNAG	4 cut(s)	47, 162, 176, 200
DpnI	GATC	6 cut(s)	103, 181, 406, 537, 595, 762
DpnII	GATC	6 cut(s)	101, 179, 404, 535, 593, 760
Eam1104I	CTCTTC	1 cut(s)	301
EarI	CTCTTC	1 cut(s)	301
Eco130I	CCWWGG	1 cut(s)	347
Eco47I	GGWCC	4 cut(s)	122, 212, 344, 744
EcoT14I	CCWWGG	1 cut(s)	347
ErhI	CCWWGG	1 cut(s)	347
FaeI	CATG	5 cut(s)	155, 317, 491, 565, 638
FatI	CATG	5 cut(s)	151, 313, 487, 561, 634
FauI	CCCGC	2 cut(s)	216, 412
FauNDI	CATATG	1 cut(s)	379
FblI	GTMKAC	1 cut(s)	672
Fnu4HI	GCNGC	1 cut(s)	335
Fsp4HI	GCNGC	1 cut(s)	335
FspBI	CTAG	1 cut(s)	369
GluI	GCNGC	1 cut(s)	335
HaeIII	GGCC	1 cut(s)	228
HapII	CCGG	1 cut(s)	215
Hin1II	CATG	5 cut(s)	155, 317, 491, 565, 638
HincII	GTYRAC	1 cut(s)	358
HindII	GTYRAC	1 cut(s)	358
HinfI	GANTC	2 cut(s)	65, 608
HpaII	CCGG	1 cut(s)	215
HphI	GGTGA	1 cut(s)	558
Hpy166II	GTNNAC	2 cut(s)	358, 673
Hpy188I	TCNGA	2 cut(s)	70, 212
Hpy188III	TCNNGA	3 cut(s)	279, 475, 764
Hpy8I	GTNNAC	2 cut(s)	358, 673
HpyAV	CCTTC	5 cut(s)	251, 260, 276, 472, 794
HpyCH4III	ACNGT	5 cut(s)	61, 135, 244, 511, 805
HpyCH4IV	ACGT	1 cut(s)	715
HpyCH4V	TGCA	1 cut(s)	302
HpyF10VI	GCNNNNNNNGC	1 cut(s)	172
HpyF3I	CTNAG	4 cut(s)	47, 162, 176, 200
HpySE526I	ACGT	1 cut(s)	715
Hsp92II	CATG	5 cut(s)	155, 317, 491, 565, 638
Kzo9I	GATC	6 cut(s)	101, 179, 404, 535, 593, 760
LweI	GCATC	2 cut(s)	240, 354
MaeI	CTAG	1 cut(s)	369
MaeII	ACGT	1 cut(s)	715
MaeIII	GTNAC	3 cut(s)	7, 511, 564
MalI	GATC	6 cut(s)	103, 181, 406, 537, 595, 762
MboI	GATC	6 cut(s)	101, 179, 404, 535, 593, 760
MboII	GAAGA	3 cut(s)	259, 288, 645
MfeI	CAATTG	1 cut(s)	15
MflI	RGATCY	2 cut(s)	404, 593
MluCI	AATT	4 cut(s)	15, 271, 698, 789
MmeI	TCCRAC	1 cut(s)	190
MnlI	CCTC	4 cut(s)	189, 213, 282, 631
MseI	TTAA	1 cut(s)	585
MspA1I	CMGCKG	1 cut(s)	337
MspI	CCGG	1 cut(s)	215
MspR9I	CCNGG	1 cut(s)	216
MunI	CAATTG	1 cut(s)	15
MwoI	GCNNNNNNNGC	1 cut(s)	172
NciI	CCSGG	1 cut(s)	216
NdeI	CATATG	1 cut(s)	379
NdeII	GATC	6 cut(s)	101, 179, 404, 535, 593, 760
NlaIII	CATG	5 cut(s)	155, 317, 491, 565, 638
NlaIV	GGNNCC	3 cut(s)	124, 227, 745
NmeAIII	GCCGAG	1 cut(s)	398
NmuCI	GTSAC	2 cut(s)	511, 564
NspI	RCATGY	1 cut(s)	565
NspV	TTCGAA	1 cut(s)	787
PfeI	GAWTC	2 cut(s)	65, 608
PkrI	GCNGC	1 cut(s)	336
PspN4I	GGNNCC	3 cut(s)	124, 227, 745
PspPI	GGNCC	5 cut(s)	122, 212, 226, 344, 744
PstI	CTGCAG	1 cut(s)	304
PstNI	CAGNNNCTG	1 cut(s)	515
PsuI	RGATCY	2 cut(s)	404, 593
RsaI	GTAC	1 cut(s)	91
RsaNI	GTAC	1 cut(s)	90
Rsr2I	CGGWCCG	1 cut(s)	212
RsrII	CGGWCCG	1 cut(s)	212
SaqAI	TTAA	1 cut(s)	585
SatI	GCNGC	1 cut(s)	335
Sau3AI	GATC	6 cut(s)	101, 179, 404, 535, 593, 760
Sau96I	GGNCC	5 cut(s)	122, 212, 226, 344, 744
ScrFI	CCNGG	1 cut(s)	216
SfaNI	GCATC	2 cut(s)	240, 354
SfcI	CTRYAG	2 cut(s)	60, 300
SfuI	TTCGAA	1 cut(s)	787
SinI	GGWCC	4 cut(s)	122, 212, 344, 744
Sse9I	AATT	4 cut(s)	15, 271, 698, 789
SsiI	CCGC	3 cut(s)	223, 335, 419
SspMI	CTAG	1 cut(s)	369
StyD4I	CCNGG	1 cut(s)	214
StyI	CCWWGG	1 cut(s)	347
TaaI	ACNGT	5 cut(s)	61, 135, 244, 511, 805
TaiI	ACGT	1 cut(s)	718
TaqI	TCGA	2 cut(s)	239, 787
TasI	AATT	4 cut(s)	15, 271, 698, 789
TauI	GCSGC	1 cut(s)	337
TfiI	GAWTC	2 cut(s)	65, 608
Tru1I	TTAA	1 cut(s)	585
Tru9I	TTAA	1 cut(s)	585
TscAI	CASTG	2 cut(s)	249, 516
TseFI	GTSAC	2 cut(s)	511, 564
Tsp45I	GTSAC	2 cut(s)	511, 564
TspDTI	ATGAA	3 cut(s)	168, 476, 566
TspGWI	ACGGA	1 cut(s)	114
TspRI	CASTG	2 cut(s)	249, 516
VpaK11BI	GGWCC	4 cut(s)	122, 212, 344, 744
XapI	RAATTY	2 cut(s)	698, 789
XceI	RCATGY	1 cut(s)	565
XmiI	GTMKAC	1 cut(s)	672
XspI	CTAG	1 cut(s)	369

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.