Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8470985.1

Orthogroup ID

OG0005635

Physical Location & Seq

Genomic Coordinates Forward (+)

144 .. 1872

Gene Structure 1729 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8470985.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 693 bp

atggctctggccacccccaccaccacatttgggttcagtaatttactcgagactttcacagtcaacgttcagagagcagagaacaggcctctgaatgtgcctctgattgctccttttacgattgcgacttcgaggcttgaacgtgttgagaatgttgctatcagagttgagttgagaaatgggtgtgtggggtggggtgaagctccaatcttgcctcatgtgactgcagaggatcagcacaccgctatggtcaaggccaaggaggcttgtgagttcttgctcaggaataatgggatgactttgagttcggttttgggagagattggtgtgcttctccctggatatgagtttgcttctgttagggcaggagtcgagatggctctaattgatgcagttgctacaagtattggtgtcccattatggagactgtttggtggagcttcaaataccataaccactgatataacgattccgatagtttctgcagctgaagctgccagattggcttcaaagtactgcaaagaaggatttaaaactttaaagcttaaggtgggaaagaatctaaattcagacatagaagtccttcaagctatacgggcagtccaccctgattgctcttttatcttggatgctaacgaaggatataactccaatgaagctatccaagttcttgagaaattatatggtacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000287 GO:0003674 GO:0003824 GO:0005488 GO:0006518 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016853 GO:0016854 GO:0016855 GO:0034641 GO:0043167 GO:0043169 GO:0043603 GO:0044237 GO:0046872 GO:0071704 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MR_MLE_C MR_MLE_N

Protein Analysis

230

Amino Acids

24.82

Weight (kDa)

5.48

Isoelectric Point (pI)

22.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005635)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G18270
fragaria_vesca	FvH4_5g16670 FvH4_5g16670 FvH4_5g16670 FvH4_5g16670 FvH4_5g16670 FvH4_5g16670
malus_domestica	MD06G1220000.v1.1 MD14G1229600.v1.1
prunus_persica	Prupe.5G224400_v2.0.a1 Prupe.5G224400_v2.0.a1
pyrus_communis	pycom14g19100 pycom14g19110
rosa_chinensis	RchiOBHm_Chr7g0179451
rosa_laevigata	RLG00000005355
rosa_multiflora	Rmu_co8470985.1_g000001
rosa_roxburghii	Rroxscaffold_3G00274010
rosa_rugosa	Rorug06G0424300 Rorug06G0424400 Rorug06G0424500 Rorug06G0424600
rosa_samantha	Rh2AG318700 Rh6AG144500 Rh7BG023500
rosa_wichuraiana	Rw4G009460 Rw4G033460 Rw5G048300 Rw7G001940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	578
AciI	CCGC	1 cut(s)	243
AclI	AACGTT	1 cut(s)	66
AclWI	GGATC	1 cut(s)	240
AcoI	YGGCCR	1 cut(s)	9
AcsI	RAATTY	1 cut(s)	565
AcuI	CTGAAG	1 cut(s)	510
AfaI	GTAC	2 cut(s)	515, 688
AfiI	CCNNNNNNNGG	1 cut(s)	30
AflII	CTTAAG	1 cut(s)	545
AflIII	ACRYGT	1 cut(s)	142
AgsI	TTSAA	4 cut(s)	140, 444, 510, 587
AjnI	CCWGG	1 cut(s)	337
AluBI	AGCT	7 cut(s)	203, 440, 488, 494, 544, 590, 659
AluI	AGCT	7 cut(s)	203, 440, 488, 494, 544, 590, 659
Alw26I	GTCTC	2 cut(s)	44, 418
AlwI	GGATC	1 cut(s)	240
Ama87I	CYCGRG	1 cut(s)	47
AoxI	GGCC	3 cut(s)	9, 86, 255
ApeKI	GCWGC	2 cut(s)	485, 494
ApoI	RAATTY	1 cut(s)	565
ArsI	GACNNNNNNTTYG	2 cut(s)	289, 321
Asp700I	GAANNNNTTC	1 cut(s)	582
AsuHPI	GGTGA	1 cut(s)	209
AvaI	CYCGRG	1 cut(s)	47
BalI	TGGCCA	1 cut(s)	11
BbvI	GCAGC	2 cut(s)	481, 497
BccI	CCATC	1 cut(s)	370
BciT130I	CCWGG	1 cut(s)	339
BcoDI	GTCTC	2 cut(s)	44, 418
BfmI	CTRYAG	2 cut(s)	225, 483
BfrI	CTTAAG	1 cut(s)	545
BglI	GCCNNNNNGGC	2 cut(s)	263, 503
BisI	GCNGC	2 cut(s)	486, 495
BlsI	GCNGC	2 cut(s)	487, 496
BmcAI	AGTACT	1 cut(s)	515
Bme1390I	CCNGG	1 cut(s)	339
BmeT110I	CYCGRG	1 cut(s)	47
BmrFI	CCNGG	1 cut(s)	339
BmsI	GCATC	2 cut(s)	379, 619
Bpu10I	CCTNAGC	1 cut(s)	281
BpuEI	CTTGAG	1 cut(s)	692
BsaJI	CCNNGG	2 cut(s)	258, 337
Bsc4I	CCNNNNNNNGG	1 cut(s)	30
BseBI	CCWGG	1 cut(s)	339
BseDI	CCNNGG	2 cut(s)	258, 337
BseGI	GGATG	2 cut(s)	300, 634
BseLI	CCNNNNNNNGG	1 cut(s)	30
BseMII	CTCAG	1 cut(s)	295
BseXI	GCAGC	2 cut(s)	481, 497
BshFI	GGCC	3 cut(s)	11, 88, 257
BsiHKCI	CYCGRG	1 cut(s)	47
BslFI	GGGAC	1 cut(s)	398
BslI	CCNNNNNNNGG	1 cut(s)	30
BsmAI	GTCTC	2 cut(s)	44, 418
BsmFI	GGGAC	1 cut(s)	398
BsnI	GGCC	3 cut(s)	11, 88, 257
BsoBI	CYCGRG	1 cut(s)	47
Bsp143I	GATC	1 cut(s)	232
BspACI	CCGC	1 cut(s)	243
BspANI	GGCC	3 cut(s)	11, 88, 257
BspCNI	CTCAG	1 cut(s)	294
BspMAI	CTGCAG	2 cut(s)	229, 487
BspPI	GGATC	1 cut(s)	240
BspTI	CTTAAG	1 cut(s)	545
BssECI	CCNNGG	2 cut(s)	258, 337
BssMI	GATC	1 cut(s)	232
BssT1I	CCWWGG	1 cut(s)	258
Bst2UI	CCWGG	1 cut(s)	339
Bst4CI	ACNGT	2 cut(s)	61, 429
BstAFI	CTTAAG	1 cut(s)	545
BstDEI	CTNAG	1 cut(s)	281
BstF5I	GGATG	2 cut(s)	300, 634
BstKTI	GATC	1 cut(s)	235
BstMAI	GTCTC	2 cut(s)	44, 418
BstMBI	GATC	1 cut(s)	232
BstMWI	GCNNNNNNNGC	5 cut(s)	263, 491, 494, 503, 596
BstNI	CCWGG	1 cut(s)	339
BstSCI	CCNGG	1 cut(s)	337
BstSFI	CTRYAG	2 cut(s)	225, 483
BstV1I	GCAGC	2 cut(s)	481, 497
BsuRI	GGCC	3 cut(s)	11, 88, 257
BtsCI	GGATG	2 cut(s)	300, 634
BtsIMutI	CAGTG	1 cut(s)	456
Csp6I	GTAC	2 cut(s)	514, 687
CspCI	CAANNNNNGTGG	4 cut(s)	10, 45, 593, 628
CviAII	CATG	2 cut(s)	218, 690
CviQI	GTAC	2 cut(s)	514, 687
DdeI	CTNAG	1 cut(s)	281
DpnI	GATC	1 cut(s)	234
DpnII	GATC	1 cut(s)	232
DraI	TTTAAA	2 cut(s)	532, 540
DrdI	GACNNNNNNGTC	1 cut(s)	578
DseDI	GACNNNNNNGTC	1 cut(s)	578
EaeI	YGGCCR	1 cut(s)	9
Eco130I	CCWWGG	1 cut(s)	258
Eco147I	AGGCCT	1 cut(s)	88
Eco57I	CTGAAG	1 cut(s)	510
Eco88I	CYCGRG	1 cut(s)	47
EcoRII	CCWGG	1 cut(s)	337
EcoT14I	CCWWGG	1 cut(s)	258
ErhI	CCWWGG	1 cut(s)	258
FaeI	CATG	2 cut(s)	221, 693
FaqI	GGGAC	1 cut(s)	398
FatI	CATG	2 cut(s)	217, 689
Fnu4HI	GCNGC	2 cut(s)	486, 495
FokI	GGATG	2 cut(s)	307, 641
Fsp4HI	GCNGC	2 cut(s)	486, 495
GluI	GCNGC	2 cut(s)	486, 495
HaeIII	GGCC	3 cut(s)	11, 88, 257
Hin1II	CATG	2 cut(s)	221, 693
HincII	GTYRAC	1 cut(s)	64
HindII	GTYRAC	1 cut(s)	64
HindIII	AAGCTT	1 cut(s)	542
HinfI	GANTC	3 cut(s)	369, 469, 559
HphI	GGTGA	1 cut(s)	209
Hpy166II	GTNNAC	2 cut(s)	64, 604
Hpy188I	TCNGA	6 cut(s)	72, 93, 105, 164, 474, 571
Hpy188III	TCNNGA	4 cut(s)	49, 283, 373, 671
Hpy8I	GTNNAC	2 cut(s)	64, 604
HpyAV	CCTTC	3 cut(s)	518, 593, 632
HpyCH4III	ACNGT	2 cut(s)	61, 429
HpyCH4IV	ACGT	2 cut(s)	66, 142
HpyCH4V	TGCA	4 cut(s)	227, 392, 485, 519
HpyF10VI	GCNNNNNNNGC	5 cut(s)	263, 491, 494, 503, 596
HpyF3I	CTNAG	1 cut(s)	281
HpySE526I	ACGT	2 cut(s)	66, 142
Hsp92II	CATG	2 cut(s)	221, 693
Kzo9I	GATC	1 cut(s)	232
LmnI	GCTCC	3 cut(s)	115, 208, 437
LpnPI	CCDG	7 cut(s)	70, 268, 324, 351, 351, 511, 621
Lsp1109I	GCAGC	2 cut(s)	481, 497
LweI	GCATC	2 cut(s)	379, 619
MaeII	ACGT	2 cut(s)	66, 142
MaeIII	GTNAC	1 cut(s)	220
MalI	GATC	1 cut(s)	234
MboI	GATC	1 cut(s)	232
MlsI	TGGCCA	1 cut(s)	11
MluCI	AATT	4 cut(s)	40, 384, 565, 677
MluNI	TGGCCA	1 cut(s)	11
MlyI	GAGTC	1 cut(s)	378
MnlI	CCTC	6 cut(s)	99, 111, 126, 223, 225, 256
Mox20I	TGGCCA	1 cut(s)	11
MroXI	GAANNNNTTC	1 cut(s)	582
MscI	TGGCCA	1 cut(s)	11
MseI	TTAA	3 cut(s)	531, 539, 546
MslI	CAYNNNNRTG	1 cut(s)	245
Msp20I	TGGCCA	1 cut(s)	11
MspA1I	CMGCKG	1 cut(s)	488
MspCI	CTTAAG	1 cut(s)	545
MspR9I	CCNGG	1 cut(s)	339
MvaI	CCWGG	1 cut(s)	339
MwoI	GCNNNNNNNGC	5 cut(s)	263, 491, 494, 503, 596
NdeII	GATC	1 cut(s)	232
NlaIII	CATG	2 cut(s)	221, 693
NmuCI	GTSAC	1 cut(s)	220
PaeR7I	CTCGAG	1 cut(s)	47
PceI	AGGCCT	1 cut(s)	88
PdmI	GAANNNNTTC	1 cut(s)	582
PfeI	GAWTC	2 cut(s)	469, 559
PkrI	GCNGC	2 cut(s)	487, 496
PleI	GAGTC	1 cut(s)	377
PpsI	GAGTC	1 cut(s)	377
Psp1406I	AACGTT	1 cut(s)	66
Psp6I	CCWGG	1 cut(s)	337
PspGI	CCWGG	1 cut(s)	337
PstI	CTGCAG	2 cut(s)	229, 487
PvuII	CAGCTG	1 cut(s)	488
RsaI	GTAC	2 cut(s)	515, 688
RsaNI	GTAC	2 cut(s)	514, 687
RseI	CAYNNNNRTG	1 cut(s)	245
SaqAI	TTAA	3 cut(s)	531, 539, 546
SatI	GCNGC	2 cut(s)	486, 495
Sau3AI	GATC	1 cut(s)	232
ScaI	AGTACT	1 cut(s)	515
SchI	GAGTC	1 cut(s)	378
ScrFI	CCNGG	1 cut(s)	339
SfaNI	GCATC	2 cut(s)	379, 619
SfcI	CTRYAG	2 cut(s)	225, 483
Sfr274I	CTCGAG	1 cut(s)	47
SlaI	CTCGAG	1 cut(s)	47
SmiMI	CAYNNNNRTG	1 cut(s)	245
SmlI	CTYRAG	3 cut(s)	47, 545, 671
SmoI	CTYRAG	3 cut(s)	47, 545, 671
Sse9I	AATT	4 cut(s)	40, 384, 565, 677
SseBI	AGGCCT	1 cut(s)	88
SsiI	CCGC	1 cut(s)	243
StuI	AGGCCT	1 cut(s)	88
StyD4I	CCNGG	1 cut(s)	337
StyI	CCWWGG	1 cut(s)	258
TaaI	ACNGT	2 cut(s)	61, 429
TaiI	ACGT	2 cut(s)	69, 145
TaqI	TCGA	3 cut(s)	48, 131, 372
TasI	AATT	4 cut(s)	40, 384, 565, 677
TatI	WGTACW	1 cut(s)	513
TfiI	GAWTC	2 cut(s)	469, 559
Tru1I	TTAA	3 cut(s)	531, 539, 546
Tru9I	TTAA	3 cut(s)	531, 539, 546
TscAI	CASTG	1 cut(s)	463
TseFI	GTSAC	1 cut(s)	220
TseI	GCWGC	2 cut(s)	485, 494
Tsp45I	GTSAC	1 cut(s)	220
TspDTI	ATGAA	1 cut(s)	669
TspRI	CASTG	1 cut(s)	463
Vha464I	CTTAAG	1 cut(s)	545
XapI	RAATTY	1 cut(s)	565
XhoI	CTCGAG	1 cut(s)	47
XmnI	GAANNNNTTC	1 cut(s)	582
ZrmI	AGTACT	1 cut(s)	515

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.