Rmu_co8473325.1_g000001

S-adenosylmethionine decarboxylase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8473325.1
Physical Location & Seq
Reverse (-)
2 .. 269
268 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8473325.1_g000001.1.cds

Sequence Viewer

Length: 268 bp
atgggtaggaagcaggaaccatatgatgaggtgttgacaaagatgatggatgcggtcaagtgtagcatagttgagactgctgacaagctctccaatgactttcttaatgcctatctgctttcagaatcaatcatgttcattttcccaattaaactcattgtgaaaacttgtggggtaaccactccattgtccttgctcaagcctttgttggatgaagctaaagatctcaagttatttccaaacgatgttgtttacacaagaggaagct

Protein Analysis

89

Amino Acids

10.02

Weight (kDa)

5.29

Isoelectric Point (pI)

15.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 53
AluBI AGCT 3 cut(s) 88, 218, 267
AluI AGCT 3 cut(s) 88, 218, 267
Alw26I GTCTC 1 cut(s) 68
BccI CCATC 1 cut(s) 40
BcoDI GTCTC 1 cut(s) 68
BglII AGATCT 1 cut(s) 223
BmiI GGNNCC 1 cut(s) 18
BmsI GCATC 1 cut(s) 40
BpuEI CTTGAG 2 cut(s) 182, 212
BsaXI ACNNNNNCTCC 2 cut(s) 74, 104
BseGI GGATG 2 cut(s) 55, 217
BsmAI GTCTC 1 cut(s) 68
Bsp143I GATC 1 cut(s) 223
BspACI CCGC 1 cut(s) 53
BspLI GGNNCC 1 cut(s) 18
BssMI GATC 1 cut(s) 223
BstEII GGTNACC 1 cut(s) 175
BstF5I GGATG 2 cut(s) 55, 217
BstKTI GATC 1 cut(s) 226
BstMAI GTCTC 1 cut(s) 68
BstMBI GATC 1 cut(s) 223
BstPI GGTNACC 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 223
BstYI RGATCY 1 cut(s) 223
BtsCI GGATG 2 cut(s) 55, 217
CviAII CATG 1 cut(s) 133
CviJI RGCY 4 cut(s) 88, 202, 218, 267
CviKI_1 RGCY 4 cut(s) 88, 202, 218, 267
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
Eco91I GGTNACC 1 cut(s) 175
EcoO65I GGTNACC 1 cut(s) 175
FaeI CATG 1 cut(s) 136
FaiI YATR 4 cut(s) 22, 24, 68, 134
FatI CATG 1 cut(s) 132
FauNDI CATATG 1 cut(s) 22
FokI GGATG 2 cut(s) 62, 224
Hin1II CATG 1 cut(s) 136
HincII GTYRAC 1 cut(s) 36
HindII GTYRAC 1 cut(s) 36
HinfI GANTC 1 cut(s) 125
Hpy166II GTNNAC 2 cut(s) 36, 253
Hpy188I TCNGA 1 cut(s) 124
Hpy8I GTNNAC 2 cut(s) 36, 253
Hsp92II CATG 1 cut(s) 136
Kzo9I GATC 1 cut(s) 223
LweI GCATC 1 cut(s) 40
MaeIII GTNAC 1 cut(s) 175
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MflI RGATCY 1 cut(s) 223
MluCI AATT 1 cut(s) 147
MmeI TCCRAC 1 cut(s) 189
MnlI CCTC 2 cut(s) 22, 254
MseI TTAA 2 cut(s) 105, 150
NdeI CATATG 1 cut(s) 22
NdeII GATC 1 cut(s) 223
NlaIII CATG 1 cut(s) 136
NlaIV GGNNCC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 125
PspEI GGTNACC 1 cut(s) 175
PspN4I GGNNCC 1 cut(s) 18
PsuI RGATCY 1 cut(s) 223
SaqAI TTAA 2 cut(s) 105, 150
Sau3AI GATC 1 cut(s) 223
SetI ASST 3 cut(s) 33, 90, 220
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 8 cut(s) 26, 70, 97, 145, 180, 205, 211, 241
SmlI CTYRAG 2 cut(s) 197, 227
SmoI CTYRAG 2 cut(s) 197, 227
Sse9I AATT 1 cut(s) 147
SsiI CCGC 1 cut(s) 53
TasI AATT 1 cut(s) 147
TfiI GAWTC 1 cut(s) 125
Tru1I TTAA 2 cut(s) 105, 150
Tru9I TTAA 2 cut(s) 105, 150
TspDTI ATGAA 2 cut(s) 127, 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.