Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8477103.1

Orthogroup ID

OG0003175

Physical Location & Seq

Genomic Coordinates Reverse (-)

162 .. 2141

Gene Structure 1980 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8477103.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1826 bp

ccctcaagatcgccatcatcggcttcggcaacttcggccaattcctcgccaaaaccctaacccgccaaggccacaccgtcctcgcctattcccgctccgaccactccaaagcggcagccgccctcggcgtctccttcttctccgacccccacgacctctgcgagcagcacccccacgtcatcctcctctgcacctccatcatctccgccgagaaagtaatcaactccctccccctccagcgcctccgccgcaacactctcttcgccgacgtcctctccgtcaaggagttctccaaagctctgttcttgaagtcccttccgagctatttcgatgtgatctgcacgcacccgatgttcgggccggagagcgcgaagaacggctggagcgggctgtgctttgtttatgagaaagtgaggattggatcggaggtgtctagagtttcgaggtgtgacaagttcttgagcattttcgagagggaagggtgtgaaatggtggaaatgagctgtgccgagcatgataagtttgcggcggggtcgcagtttattacacacactgttgggagggtgcttgagaggttggggttggagtcgacgccgattaatactagagggtatgagacattgttggatttggtggagaatacggctggggatagctttgatttgtattacgggttgtttatgtataataagaatgcgttggagatgctggagaggttggacttggctttcgaggatttgaagaagcagctttttgggaggttgcatgatgttgtgaggaaccagttgtttgggaatgctgaaaaggtgaggacgttgcaggaggagtatgtgaaccagaatggagctgcattggtgcgttcttcgaaagctgtgagaccctctaaagcacatattttggatagctccgaagatcattcaaggcttaagattggaattgttggttttggcaactttggtcagttccttgctaaaaccattgtacgccaaggccacaaggttctagcctattctcgctcagactactctgatgttgctgaacagttgggtgtttcttacttctcggacgcggatgatttttgcgaggagcatccagaagtaatactcctttgcacatcgattctttccactgagaaagttttgatgtcactcccgcttcagaggttgaagcggagtactttgtttgttgatgttctatccgtgaaagaattcccaaaaaacctgtttcttcaaaatttgcctctagattttgatattctctgcacgcatcctatgtttggaccagaaagtggtaaaaatggctggaatggtcttgcttttgtttatgataggatcagaattggaaatgacgaatcaagggtgtcaaggtgtgatcaatttcttgatatttttgcgcaagaagggtgtcgaatggtggatatggcttgcgaagagcatgataagcatgcagcagggtcacaattcatcacacacactatgggaagagttttggaaaagttgggtttggagtcgacgccggtcaatacaaaaggttacaagactttgttgaatttggtggagaatacagcaggagatagctttgatctctactatggattgttcatgtacaatgtaaatgcaatggagcagctaaagaggcttgaccttgcatttgaagcattaaagaaacagctttttgggcggttgcatggtgttcttcggaagcaactttttgagaatgcagatgattctcaagttatgaaggagcagcatttgttgccaacaccattggagaatgaatctgcagcgacgccttctttcaaggctcttaacagtcagaacaactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00400 ko01100 ko01110 ko01230 map00400 map01100 map01110 map01230

Pfam Domains

Protein Families

F420_oxidored PDH

Protein Analysis

607

Amino Acids

68.34

Weight (kDa)

6.13

Isoelectric Point (pI)

36.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003175)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G34930 AT5G34930 AT5G34930
fragaria_vesca	FvH4_1g02170 FvH4_1g02170 FvH4_6g26860 FvH4_6g26860
malus_domestica	MD02G1020800.v1.1
prunus_persica	Prupe.7G250700_v2.0.a1
pyrus_communis	pycom02g01820
rosa_chinensis	RchiOBHm_Chr2g0087271 RchiOBHm_Chr2g0128231 RchiOBHm_Chr2g0128291
rosa_laevigata	RLG00000015849 RLG00000019002
rosa_multiflora	Rmu_co8477103.1_g000001 Rmu_sc0000837.1_g000012 Rmu_sc0003367.1_g000016 Rmu_sc0003465.1_g000004
rosa_roxburghii	Rroxscaffold_2G00115470 Rroxscaffold_2G00115930 Rroxscaffold_2G00153760
rosa_rugosa	Rorug01G0473400 Rorug01G0473500 Rorug02G0278800
rosa_samantha	Rh2AG027200 Rh2AG331500 Rh2AG332000 Rh2BG026500 Rh2BG339700 Rh2BG340300 Rh2CG027600 Rh2CG318000 Rh2DG027200 Rh2DG356600
rosa_wichuraiana	Rw2G002140 Rw2G026820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	272
Acc16I	TGCGCA	1 cut(s)	1394
AccB7I	CCANNNNNTGG	1 cut(s)	1288
AccBSI	CCGCTC	2 cut(s)	95, 386
AccI	GTMKAC	2 cut(s)	589, 1510
AccII	CGCG	2 cut(s)	370, 1069
AclWI	GGATC	2 cut(s)	429, 1339
AcoI	YGGCCR	1 cut(s)	36
AcsI	RAATTY	3 cut(s)	1207, 1233, 1548
AcuI	CTGAAG	1 cut(s)	1141
AcyI	GRCGYC	5 cut(s)	128, 269, 592, 1513, 1789
AfaI	GTAC	3 cut(s)	983, 1176, 1606
AfiI	CCNNNNNNNGG	3 cut(s)	355, 1276, 1288
AflII	CTTAAG	1 cut(s)	925
AgsI	TTSAA	8 cut(s)	309, 741, 920, 1167, 1231, 1548, 1654, 1800
AjiI	CACGTC	1 cut(s)	177
AjuI	GAANNNNNNNTTGG	2 cut(s)	286, 318
Alw26I	GTCTC	3 cut(s)	135, 610, 870
AlwI	GGATC	2 cut(s)	429, 1339
AoxI	GGCC	4 cut(s)	36, 69, 358, 990
ApeKI	GCWGC	8 cut(s)	115, 165, 747, 847, 1447, 1626, 1746, 1783
ApoI	RAATTY	3 cut(s)	1207, 1233, 1548
ArsI	GACNNNNNNTTYG	4 cut(s)	712, 744, 1633, 1665
AseI	ATTAAT	1 cut(s)	599
Asp700I	GAANNNNTTC	1 cut(s)	1207
AspLEI	GCGC	3 cut(s)	242, 370, 1395
AspS9I	GGNCC	2 cut(s)	358, 1279
AsuHPI	GGTGA	1 cut(s)	819
AsuII	TTCGAA	1 cut(s)	865
AvaII	GGWCC	1 cut(s)	1279
BbvI	GCAGC	8 cut(s)	127, 177, 759, 834, 1459, 1638, 1758, 1795
BccI	CCATC	2 cut(s)	22, 205
BceAI	ACGGC	2 cut(s)	393, 659
BclI	TGATCA	1 cut(s)	1371
BcoDI	GTCTC	3 cut(s)	135, 610, 870
BfaI	CTAG	4 cut(s)	434, 605, 1003, 1243
BfmI	CTRYAG	1 cut(s)	1781
BfoI	RGCGCY	1 cut(s)	243
BfrI	CTTAAG	1 cut(s)	925
BmcAI	AGTACT	1 cut(s)	1176
Bme18I	GGWCC	1 cut(s)	1279
BmgBI	CACGTC	1 cut(s)	177
BmgT120I	GGNCC	2 cut(s)	358, 1279
BmiI	GGNNCC	1 cut(s)	781
BmsI	GCATC	3 cut(s)	695, 1098, 1275
BoxI	GACNNNNGTC	1 cut(s)	1516
BpmI	CTGGAG	3 cut(s)	220, 402, 730
Bpu14I	TTCGAA	1 cut(s)	865
BpuEI	CTTGAG	3 cut(s)	480, 589, 1715
Bsa29I	ATCGAT	1 cut(s)	1117
BsaBI	GATNNNNATC	1 cut(s)	13
BsaHI	GRCGYC	5 cut(s)	128, 269, 592, 1513, 1789
BsaI	GGTCTC	1 cut(s)	870
BsaJI	CCNNGG	3 cut(s)	66, 123, 987
BsaXI	ACNNNNNCTCC	2 cut(s)	259, 289
Bsc4I	CCNNNNNNNGG	3 cut(s)	355, 1276, 1288
Bse118I	RCCGGY	1 cut(s)	1515
Bse1I	ACTGG	1 cut(s)	783
Bse3DI	GCAATG	1 cut(s)	1625
Bse8I	GATNNNNATC	1 cut(s)	13
BseCI	ATCGAT	1 cut(s)	1117
BseDI	CCNNGG	3 cut(s)	66, 123, 987
BseGI	GGATG	4 cut(s)	179, 1077, 1089, 1266
BseJI	GATNNNNATC	1 cut(s)	13
BseLI	CCNNNNNNNGG	3 cut(s)	355, 1276, 1288
BseMI	GCAATG	1 cut(s)	1625
BseMII	CTCAG	2 cut(s)	1031, 1121
BseNI	ACTGG	1 cut(s)	783
BseRI	GAGGAG	3 cut(s)	175, 838, 1099
BseXI	GCAGC	8 cut(s)	127, 177, 759, 834, 1459, 1638, 1758, 1795
BseYI	CCCAGC	1 cut(s)	646
BsgI	GTGCAG	3 cut(s)	174, 324, 1245
Bsh1236I	CGCG	2 cut(s)	370, 1069
BshFI	GGCC	4 cut(s)	38, 71, 360, 992
BshVI	ATCGAT	1 cut(s)	1117
BsiSI	CCGG	2 cut(s)	361, 1516
BslFI	GGGAC	1 cut(s)	297
BslI	CCNNNNNNNGG	3 cut(s)	355, 1276, 1288
BsmAI	GTCTC	3 cut(s)	135, 610, 870
BsmBI	CGTCTC	1 cut(s)	135
BsmFI	GGGAC	1 cut(s)	297
BsmI	GAATGC	3 cut(s)	699, 801, 1722
BsnI	GGCC	4 cut(s)	38, 71, 360, 992
Bso31I	GGTCTC	1 cut(s)	870
Bsp119I	TTCGAA	1 cut(s)	865
Bsp1407I	TGTACA	1 cut(s)	1604
Bsp143I	GATC	7 cut(s)	8, 335, 421, 912, 1331, 1371, 1581
BspANI	GGCC	4 cut(s)	38, 71, 360, 992
BspCNI	CTCAG	2 cut(s)	1030, 1122
BspDI	ATCGAT	1 cut(s)	1117
BspFNI	CGCG	2 cut(s)	370, 1069
BspLI	GGNNCC	1 cut(s)	781
BspMAI	CTGCAG	1 cut(s)	1785
BspPI	GGATC	2 cut(s)	429, 1339
BspQI	GCTCTTC	1 cut(s)	1424
BspT104I	TTCGAA	1 cut(s)	865
BspTI	CTTAAG	1 cut(s)	925
BspTNI	GGTCTC	1 cut(s)	870
BsrBI	CCGCTC	2 cut(s)	95, 386
BsrDI	GCAATG	1 cut(s)	1625
BsrFI	RCCGGY	1 cut(s)	1515
BsrGI	TGTACA	1 cut(s)	1604
BsrI	ACTGG	1 cut(s)	783
BssAI	RCCGGY	1 cut(s)	1515
BssECI	CCNNGG	3 cut(s)	66, 123, 987
BssMI	GATC	7 cut(s)	8, 335, 421, 912, 1331, 1371, 1581
BssNI	GRCGYC	5 cut(s)	128, 269, 592, 1513, 1789
BssT1I	CCWWGG	2 cut(s)	66, 987
Bst4CI	ACNGT	4 cut(s)	78, 555, 1043, 1813
Bst6I	CTCTTC	3 cut(s)	265, 1424, 1476
BstACI	GRCGYC	5 cut(s)	128, 269, 592, 1513, 1789
BstAFI	CTTAAG	1 cut(s)	925
BstAPI	GCANNNNNTGC	1 cut(s)	1755
BstAUI	TGTACA	1 cut(s)	1604
BstBI	TTCGAA	1 cut(s)	865
BstC8I	GCNNGC	6 cut(s)	163, 343, 388, 1264, 1425, 1445
BstDEI	CTNAG	2 cut(s)	1017, 1130
BstF5I	GGATG	4 cut(s)	179, 1077, 1089, 1266
BstFNI	CGCG	2 cut(s)	370, 1069
BstH2I	RGCGCY	1 cut(s)	243
BstHHI	GCGC	3 cut(s)	242, 370, 1395
BstKTI	GATC	7 cut(s)	11, 338, 424, 915, 1334, 1374, 1584
BstMAI	GTCTC	3 cut(s)	135, 610, 870
BstMBI	GATC	7 cut(s)	8, 335, 421, 912, 1331, 1371, 1581
BstMWI	GCNNNNNNNGC	9 cut(s)	35, 118, 248, 392, 1440, 1635, 1654, 1677, 1755
BstNSI	RCATGY	1 cut(s)	1447
BstPAI	GACNNNNGTC	1 cut(s)	1516
BstSFI	CTRYAG	1 cut(s)	1781
BstUI	CGCG	2 cut(s)	370, 1069
BstV1I	GCAGC	8 cut(s)	127, 177, 759, 834, 1459, 1638, 1758, 1795
BstXI	CCANNNNNNTGG	1 cut(s)	790
Bsu15I	ATCGAT	1 cut(s)	1117
BsuRI	GGCC	4 cut(s)	38, 71, 360, 992
BsuTUI	ATCGAT	1 cut(s)	1117
BtrI	CACGTC	1 cut(s)	177
BtsCI	GGATG	4 cut(s)	179, 1077, 1089, 1266
BtsIMutI	CAGTG	2 cut(s)	551, 1127
Cac8I	GCNNGC	6 cut(s)	163, 343, 388, 1264, 1425, 1445
CfoI	GCGC	3 cut(s)	242, 370, 1395
Cfr10I	RCCGGY	1 cut(s)	1515
Cfr13I	GGNCC	2 cut(s)	358, 1279
ClaI	ATCGAT	1 cut(s)	1117
CseI	GACGC	5 cut(s)	117, 600, 1075, 1521, 1797
Csp6I	GTAC	3 cut(s)	982, 1175, 1605
CviAII	CATG	6 cut(s)	514, 766, 1435, 1444, 1602, 1687
CviQI	GTAC	3 cut(s)	982, 1175, 1605
DdeI	CTNAG	2 cut(s)	1017, 1130
DpnI	GATC	7 cut(s)	10, 337, 423, 914, 1333, 1373, 1583
DpnII	GATC	7 cut(s)	8, 335, 421, 912, 1331, 1371, 1581
EaeI	YGGCCR	1 cut(s)	36
Eam1104I	CTCTTC	3 cut(s)	265, 1424, 1476
EarI	CTCTTC	3 cut(s)	265, 1424, 1476
EciI	GGCGGA	2 cut(s)	195, 235
Eco130I	CCWWGG	2 cut(s)	66, 987
Eco31I	GGTCTC	1 cut(s)	870
Eco47I	GGWCC	1 cut(s)	1279
Eco57I	CTGAAG	1 cut(s)	1141
EcoRI	GAATTC	1 cut(s)	1207
EcoT14I	CCWWGG	2 cut(s)	66, 987
ErhI	CCWWGG	2 cut(s)	66, 987
Esp3I	CGTCTC	1 cut(s)	135
FaeI	CATG	6 cut(s)	517, 769, 1438, 1447, 1605, 1690
FaqI	GGGAC	1 cut(s)	297
FatI	CATG	6 cut(s)	513, 765, 1434, 1443, 1601, 1686
FauI	CCCGC	5 cut(s)	70, 100, 379, 522, 1160
FbaI	TGATCA	1 cut(s)	1371
FblI	GTMKAC	2 cut(s)	589, 1510
FokI	GGATG	4 cut(s)	166, 1076, 1084, 1253
FspBI	CTAG	4 cut(s)	434, 605, 1003, 1243
FspI	TGCGCA	1 cut(s)	1394
GlaI	GCGC	3 cut(s)	241, 369, 1394
GsaI	CCCAGC	1 cut(s)	650
GsuI	CTGGAG	3 cut(s)	220, 402, 730
HaeII	RGCGCY	1 cut(s)	243
HaeIII	GGCC	4 cut(s)	38, 71, 360, 992
HapII	CCGG	2 cut(s)	361, 1516
HgaI	GACGC	5 cut(s)	117, 600, 1075, 1521, 1797
HhaI	GCGC	3 cut(s)	242, 370, 1395
Hin1I	GRCGYC	5 cut(s)	128, 269, 592, 1513, 1789
Hin1II	CATG	6 cut(s)	517, 769, 1438, 1447, 1605, 1690
Hin6I	GCGC	3 cut(s)	240, 368, 1393
HinP1I	GCGC	3 cut(s)	240, 368, 1393
HincII	GTYRAC	2 cut(s)	590, 1511
HindII	GTYRAC	2 cut(s)	590, 1511
HinfI	GANTC	6 cut(s)	586, 1119, 1351, 1507, 1726, 1777
HpaII	CCGG	2 cut(s)	361, 1516
HphI	GGTGA	1 cut(s)	819
Hpy166II	GTNNAC	3 cut(s)	590, 834, 1511
Hpy188III	TCNNGA	8 cut(s)	6, 306, 434, 459, 471, 1093, 1243, 1381
Hpy8I	GTNNAC	3 cut(s)	590, 834, 1511
Hpy99I	CGWCG	4 cut(s)	271, 594, 1515, 1791
HpyAV	CCTTC	6 cut(s)	144, 325, 472, 1393, 1734, 1802
HpyCH4III	ACNGT	4 cut(s)	78, 555, 1043, 1813
HpyCH4IV	ACGT	3 cut(s)	176, 269, 814
HpyF10VI	GCNNNNNNNGC	9 cut(s)	35, 118, 248, 392, 1440, 1635, 1654, 1677, 1755
HpyF3I	CTNAG	2 cut(s)	1017, 1130
HpySE526I	ACGT	3 cut(s)	176, 269, 814
Hsp92I	GRCGYC	5 cut(s)	128, 269, 592, 1513, 1789
Hsp92II	CATG	6 cut(s)	517, 769, 1438, 1447, 1605, 1690
HspAI	GCGC	3 cut(s)	240, 368, 1393
Ksp22I	TGATCA	1 cut(s)	1371
Kzo9I	GATC	7 cut(s)	8, 335, 421, 912, 1331, 1371, 1581
LguI	GCTCTTC	1 cut(s)	1424
LmnI	GCTCC	7 cut(s)	100, 383, 844, 910, 1086, 1623, 1743
Lsp1109I	GCAGC	8 cut(s)	127, 177, 759, 834, 1459, 1638, 1758, 1795
LweI	GCATC	3 cut(s)	695, 1098, 1275
MaeI	CTAG	4 cut(s)	434, 605, 1003, 1243
MaeII	ACGT	3 cut(s)	176, 269, 814
MaeIII	GTNAC	4 cut(s)	448, 1145, 1454, 1531
MalI	GATC	7 cut(s)	10, 337, 423, 914, 1333, 1373, 1583
MbiI	CCGCTC	2 cut(s)	95, 386
MboI	GATC	7 cut(s)	8, 335, 421, 912, 1331, 1371, 1581
MluCI	AATT	8 cut(s)	40, 935, 1207, 1233, 1337, 1375, 1459, 1548
MlyI	GAGTC	2 cut(s)	595, 1516
MmeI	TCCRAC	6 cut(s)	122, 167, 563, 605, 680, 698
MroXI	GAANNNNTTC	1 cut(s)	1207
MseI	TTAA	4 cut(s)	599, 926, 1660, 1808
MspCI	CTTAAG	1 cut(s)	925
MspI	CCGG	2 cut(s)	361, 1516
Mva1269I	GAATGC	3 cut(s)	699, 801, 1722
MvnI	CGCG	2 cut(s)	370, 1069
MwoI	GCNNNNNNNGC	9 cut(s)	35, 118, 248, 392, 1440, 1635, 1654, 1677, 1755
NdeII	GATC	7 cut(s)	8, 335, 421, 912, 1331, 1371, 1581
NlaIII	CATG	6 cut(s)	517, 769, 1438, 1447, 1605, 1690
NlaIV	GGNNCC	1 cut(s)	781
NmeAIII	GCCGAG	3 cut(s)	104, 234, 534
NmuCI	GTSAC	3 cut(s)	448, 1145, 1454
NsbI	TGCGCA	1 cut(s)	1394
NspI	RCATGY	1 cut(s)	1447
NspV	TTCGAA	1 cut(s)	865
PaeI	GCATGC	1 cut(s)	1447
PciSI	GCTCTTC	1 cut(s)	1424
PcsI	WCGNNNNNNNCGW	2 cut(s)	158, 275
PctI	GAATGC	3 cut(s)	699, 801, 1722
PdmI	GAANNNNTTC	1 cut(s)	1207
PfeI	GAWTC	4 cut(s)	1119, 1351, 1726, 1777
PflMI	CCANNNNNTGG	1 cut(s)	1288
PleI	GAGTC	2 cut(s)	594, 1515
PpsI	GAGTC	2 cut(s)	594, 1515
PshAI	GACNNNNGTC	1 cut(s)	1516
PshBI	ATTAAT	1 cut(s)	599
PspFI	CCCAGC	1 cut(s)	646
PspN4I	GGNNCC	1 cut(s)	781
PspPI	GGNCC	2 cut(s)	358, 1279
PstI	CTGCAG	1 cut(s)	1785
RsaI	GTAC	3 cut(s)	983, 1176, 1606
RsaNI	GTAC	3 cut(s)	982, 1175, 1605
SalI	GTCGAC	2 cut(s)	588, 1509
SapI	GCTCTTC	1 cut(s)	1424
SaqAI	TTAA	4 cut(s)	599, 926, 1660, 1808
Sau3AI	GATC	7 cut(s)	8, 335, 421, 912, 1331, 1371, 1581
Sau96I	GGNCC	2 cut(s)	358, 1279
ScaI	AGTACT	1 cut(s)	1176
SchI	GAGTC	2 cut(s)	595, 1516
SfaNI	GCATC	3 cut(s)	695, 1098, 1275
SfcI	CTRYAG	1 cut(s)	1781
SfuI	TTCGAA	1 cut(s)	865
SinI	GGWCC	1 cut(s)	1279
SmlI	CTYRAG	5 cut(s)	4, 459, 568, 925, 1730
SmoI	CTYRAG	5 cut(s)	4, 459, 568, 925, 1730
SphI	GCATGC	1 cut(s)	1447
Sse9I	AATT	8 cut(s)	40, 935, 1207, 1233, 1337, 1375, 1459, 1548
SspMI	CTAG	4 cut(s)	434, 605, 1003, 1243
StyI	CCWWGG	2 cut(s)	66, 987
TaaI	ACNGT	4 cut(s)	78, 555, 1043, 1813
TaiI	ACGT	3 cut(s)	179, 272, 817
TaqI	TCGA	9 cut(s)	329, 442, 470, 589, 731, 865, 1117, 1407, 1510
TasI	AATT	8 cut(s)	40, 935, 1207, 1233, 1337, 1375, 1459, 1548
TatI	WGTACW	2 cut(s)	1174, 1604
TauI	GCSGC	4 cut(s)	115, 121, 251, 529
TfiI	GAWTC	4 cut(s)	1119, 1351, 1726, 1777
Tru1I	TTAA	4 cut(s)	599, 926, 1660, 1808
Tru9I	TTAA	4 cut(s)	599, 926, 1660, 1808
TscAI	CASTG	2 cut(s)	558, 1134
TseFI	GTSAC	3 cut(s)	448, 1145, 1454
TseI	GCWGC	8 cut(s)	115, 165, 747, 847, 1447, 1626, 1746, 1783
Tsp45I	GTSAC	3 cut(s)	448, 1145, 1454
TspDTI	ATGAA	4 cut(s)	1452, 1590, 1753, 1790
TspGWI	ACGGA	2 cut(s)	267, 1188
TspRI	CASTG	2 cut(s)	558, 1134
Van91I	CCANNNNNTGG	1 cut(s)	1288
Vha464I	CTTAAG	1 cut(s)	925
VpaK11BI	GGWCC	1 cut(s)	1279
VspI	ATTAAT	1 cut(s)	599
XapI	RAATTY	3 cut(s)	1207, 1233, 1548
XbaI	TCTAGA	2 cut(s)	433, 1242
XceI	RCATGY	1 cut(s)	1447
XmiI	GTMKAC	2 cut(s)	589, 1510
XmnI	GAANNNNTTC	1 cut(s)	1207
XspI	CTAG	4 cut(s)	434, 605, 1003, 1243
ZraI	GACGTC	1 cut(s)	270
ZrmI	AGTACT	1 cut(s)	1176

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.