Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000837.1

Orthogroup ID

OG0003175

Physical Location & Seq

Genomic Coordinates Reverse (-)

48817 .. 51224

Gene Structure 2408 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000837.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1806 bp

atgctcaagattgccatcattggttttggcaacttgggccaatcccttgccaagacctttgctaacctaggccacatcgtccttgcacattctagatgtgaccactccaaaatggcccaagacctcggcatttcatatttgtctgacctgcaagacctctgtgaacagaatccacaggtcattttgctatgcacctccataatctccacagaatccgtcctcaaatctttacctctccaacgccttaggcatgacacattgtttgttgacatgcttcctgtcaaagagttttcaaaggcattgttactcaagttgttgcctagctattttgatgtcctttgcaccaacccaatattcggagttgagagaggcaaacatgaatggaatggcatgttttttgtgtacgaaaaggctcgaattggctctgacggagtggggatttctctctgtgataacttcttaaacatatttgagaaagaagggtgtaggatggtggaagtaagctgttcagagcaggataagtatgccgcaggttcacagtttattacccacgcagttgggagagtcttggggatgttgccattggaatcgactccaataaatacaaaaggttatgaaacattgttgcatttggtggacaacacagctagggatagttttgatttatattatgagttgtttatgtacaacaaaaatgcatttgagatgtttgagaggttggacttggcttttgacactttgaagaaacagctttctggttatttgcatgatgttgtgagagagcaagtatatgatgatgcagagaaggtaaaaatggggcacgaggggtacaaggtgtctaacccatctcacaatggagctgcctccgaatcttcttcaaaagctatgaggtcgcataagattgctcaggtatctaacagtaaagcacagataatatctgaccactttgatgacaactcaaggctcaagattgcagttgttggttttgggaactttggtcagtttcttgctaaaactattatacgtcaaggtcatatagttctagcctattctcgatcagactactatgatgtggctcaaaagttgggggtaacttactgctctgatgtcgaggaactttgcaaagagaatccagaagtgatacttttttgtacctctattctttcaactgagaaagttctcaggtcatttccagttcagaggttgatgaggaatactttgtttgttgatgttctttctgttaaagaatttccaaaaaacttgtttcttcaaaagttgccattgaattttgatattctctgtactcatcctatgtttggaccagagagtggtaaaaatgggtgggaggctcttccttttgtttatgataaggtcagggtgggaagtgacgaatcaagggtatcactctgtgaccgatttcttgatatctttgctcttgaagggtgtcgaatggttgaaatgtcttgtgcagagcatgataggcatgcagcagggtcacaattccttacacacacaataggaagggttttggagaagctaggtttggagtcgacacctatctttacaaatggttacaagactttgttgaatttggtggagactacagtaggagatagttttgatctttactatggcttgttcatgtataatgtaaatgcaatggaccagctaaatagattgggcatggcttttgactcattagaggagcagtttttggggcgtttgcatggtgttctccataagcaacattctgagaatgcaagcaaaagcttgttgccaaatcatccaagaatgcagctccactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00400 ko01100 ko01110 ko01230 map00400 map01100 map01110 map01230

Pfam Domains

Protein Families

F420_oxidored PDH

Protein Analysis

601

Amino Acids

67.83

Weight (kDa)

6.07

Isoelectric Point (pI)

35.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003175)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G34930 AT5G34930 AT5G34930
fragaria_vesca	FvH4_1g02170 FvH4_1g02170 FvH4_6g26860 FvH4_6g26860
malus_domestica	MD02G1020800.v1.1
prunus_persica	Prupe.7G250700_v2.0.a1
pyrus_communis	pycom02g01820
rosa_chinensis	RchiOBHm_Chr2g0087271 RchiOBHm_Chr2g0128231 RchiOBHm_Chr2g0128291
rosa_laevigata	RLG00000015849 RLG00000019002
rosa_multiflora	Rmu_co8477103.1_g000001 Rmu_sc0000837.1_g000012 Rmu_sc0003367.1_g000016 Rmu_sc0003465.1_g000004
rosa_roxburghii	Rroxscaffold_2G00115470 Rroxscaffold_2G00115930 Rroxscaffold_2G00153760
rosa_rugosa	Rorug01G0473400 Rorug01G0473500 Rorug02G0278800
rosa_samantha	Rh2AG027200 Rh2AG331500 Rh2AG332000 Rh2BG026500 Rh2BG339700 Rh2BG340300 Rh2CG027600 Rh2CG318000 Rh2DG027200 Rh2DG356600
rosa_wichuraiana	Rw2G002140 Rw2G026820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	156, 521
AccB7I	CCANNNNNTGG	1 cut(s)	1328
AccI	GTMKAC	1 cut(s)	1550
AciI	CCGC	1 cut(s)	528
AcsI	RAATTY	3 cut(s)	1247, 1285, 1588
AdeI	CACNNNGTG	1 cut(s)	1409
AfaI	GTAC	5 cut(s)	404, 686, 830, 1153, 1303
AfiI	CCNNNNNNNGG	3 cut(s)	356, 1316, 1328
AgsI	TTSAA	9 cut(s)	294, 742, 879, 1167, 1271, 1285, 1439, 1457, 1588
AjuI	GAANNNNNNNTTGG	4 cut(s)	338, 370, 1526, 1558
Alw26I	GTCTC	1 cut(s)	1592
AoxI	GGCC	3 cut(s)	37, 70, 114
ApeKI	GCWGC	3 cut(s)	860, 1487, 1795
ApoI	RAATTY	3 cut(s)	1247, 1285, 1588
ArsI	GACNNNNNNTTYG	4 cut(s)	245, 277, 713, 745
AspA2I	CCTAGG	1 cut(s)	67
AspS9I	GGNCC	4 cut(s)	37, 115, 1319, 1663
AvaII	GGWCC	2 cut(s)	1319, 1663
AvrII	CCTAGG	1 cut(s)	67
AxyI	CCTNAGG	1 cut(s)	245
BaeGI	GKGCMC	1 cut(s)	822
BauI	CACGAG	1 cut(s)	821
BbvI	GCAGC	2 cut(s)	847, 1499
BccI	CCATC	3 cut(s)	23, 484, 853
BcoDI	GTCTC	1 cut(s)	1592
BfaI	CTAG	6 cut(s)	68, 93, 321, 648, 1043, 1538
BfmI	CTRYAG	1 cut(s)	1602
BfuAI	ACCTGC	2 cut(s)	156, 521
BisI	GCNGC	4 cut(s)	528, 861, 1488, 1796
BlnI	CCTAGG	1 cut(s)	67
BlsI	GCNGC	4 cut(s)	529, 862, 1489, 1797
Bme18I	GGWCC	2 cut(s)	1319, 1663
BmgT120I	GGNCC	4 cut(s)	37, 115, 1319, 1663
BmsI	GCATC	1 cut(s)	787
Bpu10I	CCTNAGC	1 cut(s)	906
BpuEI	CTTGAG	3 cut(s)	293, 943, 950
BsaBI	GATNNNNATC	1 cut(s)	14
BsaJI	CCNNGG	2 cut(s)	67, 124
Bsc4I	CCNNNNNNNGG	3 cut(s)	356, 1316, 1328
Bse1I	ACTGG	1 cut(s)	1193
Bse21I	CCTNAGG	1 cut(s)	245
Bse3DI	GCAATG	1 cut(s)	1665
Bse8I	GATNNNNATC	1 cut(s)	14
BseDI	CCNNGG	2 cut(s)	67, 124
BseGI	GGATG	4 cut(s)	495, 579, 1306, 1783
BseJI	GATNNNNATC	1 cut(s)	14
BseLI	CCNNNNNNNGG	3 cut(s)	356, 1316, 1328
BseMI	GCAATG	1 cut(s)	1665
BseMII	CTCAG	4 cut(s)	920, 1161, 1195, 1743
BseNI	ACTGG	1 cut(s)	1193
BseRI	GAGGAG	1 cut(s)	1718
BseSI	GKGCMC	1 cut(s)	822
BseXI	GCAGC	2 cut(s)	847, 1499
BsgI	GTGCAG	1 cut(s)	1488
BshFI	GGCC	3 cut(s)	39, 72, 116
BslI	CCNNNNNNNGG	3 cut(s)	356, 1316, 1328
BsmAI	GTCTC	1 cut(s)	1592
BsmI	GAATGC	2 cut(s)	1762, 1797
BsnI	GGCC	3 cut(s)	39, 72, 116
Bsp1286I	GDGCHC	1 cut(s)	822
Bsp1407I	TGTACA	1 cut(s)	684
Bsp143I	GATC	2 cut(s)	1055, 1621
BspACI	CCGC	1 cut(s)	528
BspANI	GGCC	3 cut(s)	39, 72, 116
BspCNI	CTCAG	4 cut(s)	919, 1162, 1194, 1744
BspMI	ACCTGC	2 cut(s)	156, 521
BspQI	GCTCTTC	1 cut(s)	1356
BsrDI	GCAATG	1 cut(s)	1665
BsrGI	TGTACA	1 cut(s)	684
BsrI	ACTGG	1 cut(s)	1193
BssECI	CCNNGG	2 cut(s)	67, 124
BssMI	GATC	2 cut(s)	1055, 1621
BssSI	CACGAG	1 cut(s)	821
BssT1I	CCWWGG	1 cut(s)	67
Bst2BI	CACGAG	1 cut(s)	821
Bst4CI	ACNGT	3 cut(s)	540, 920, 1606
Bst6I	CTCTTC	1 cut(s)	1356
BstAUI	TGTACA	1 cut(s)	684
BstC8I	GCNNGC	2 cut(s)	1485, 1762
BstDEI	CTNAG	5 cut(s)	245, 906, 1170, 1181, 1752
BstF5I	GGATG	4 cut(s)	495, 579, 1306, 1783
BstKTI	GATC	2 cut(s)	1058, 1624
BstMAI	GTCTC	1 cut(s)	1592
BstMBI	GATC	2 cut(s)	1055, 1621
BstMWI	GCNNNNNNNGC	2 cut(s)	36, 1480
BstNSI	RCATGY	3 cut(s)	274, 394, 1487
BstSFI	CTRYAG	1 cut(s)	1602
BstSLI	GKGCMC	1 cut(s)	822
BstV1I	GCAGC	2 cut(s)	847, 1499
BstXI	CCANNNNNNTGG	1 cut(s)	557
Bsu36I	CCTNAGG	1 cut(s)	245
BsuRI	GGCC	3 cut(s)	39, 72, 116
BtsCI	GGATG	4 cut(s)	495, 579, 1306, 1783
BveI	ACCTGC	2 cut(s)	156, 521
Cac8I	GCNNGC	2 cut(s)	1485, 1762
Cfr13I	GGNCC	4 cut(s)	37, 115, 1319, 1663
Csp6I	GTAC	5 cut(s)	403, 685, 829, 1152, 1302
CviQI	GTAC	5 cut(s)	403, 685, 829, 1152, 1302
DdeI	CTNAG	5 cut(s)	245, 906, 1170, 1181, 1752
DpnI	GATC	2 cut(s)	1057, 1623
DpnII	GATC	2 cut(s)	1055, 1621
DraIII	CACNNNGTG	1 cut(s)	1409
Eam1104I	CTCTTC	1 cut(s)	1356
EarI	CTCTTC	1 cut(s)	1356
Eco130I	CCWWGG	1 cut(s)	67
Eco32I	GATATC	1 cut(s)	1426
Eco47I	GGWCC	2 cut(s)	1319, 1663
Eco81I	CCTNAGG	1 cut(s)	245
EcoRV	GATATC	1 cut(s)	1426
EcoT14I	CCWWGG	1 cut(s)	67
EcoT22I	ATGCAT	1 cut(s)	700
ErhI	CCWWGG	1 cut(s)	67
FalI	AAGNNNNNCTT	2 cut(s)	1128, 1160
FblI	GTMKAC	1 cut(s)	1550
Fnu4HI	GCNGC	4 cut(s)	528, 861, 1488, 1796
FokI	GGATG	4 cut(s)	502, 586, 1293, 1770
Fsp4HI	GCNGC	4 cut(s)	528, 861, 1488, 1796
FspBI	CTAG	6 cut(s)	68, 93, 321, 648, 1043, 1538
GluI	GCNGC	4 cut(s)	528, 861, 1488, 1796
HaeIII	GGCC	3 cut(s)	39, 72, 116
HincII	GTYRAC	2 cut(s)	268, 1551
HindII	GTYRAC	2 cut(s)	268, 1551
HindIII	AAGCTT	1 cut(s)	1768
Hpy166II	GTNNAC	6 cut(s)	164, 268, 403, 536, 637, 1551
Hpy188III	TCNNGA	7 cut(s)	7, 93, 967, 1053, 1133, 1421, 1436
Hpy8I	GTNNAC	6 cut(s)	164, 268, 403, 536, 637, 1551
HpyAV	CCTTC	4 cut(s)	473, 799, 1433, 1515
HpyCH4III	ACNGT	3 cut(s)	540, 920, 1606
HpyCH4IV	ACGT	1 cut(s)	1024
HpyF10VI	GCNNNNNNNGC	2 cut(s)	36, 1480
HpyF3I	CTNAG	5 cut(s)	245, 906, 1170, 1181, 1752
HpySE526I	ACGT	1 cut(s)	1024
Kzo9I	GATC	2 cut(s)	1055, 1621
LguI	GCTCTTC	1 cut(s)	1356
LmnI	GCTCC	3 cut(s)	857, 1705, 1803
Lsp1109I	GCAGC	2 cut(s)	847, 1499
LweI	GCATC	1 cut(s)	787
MaeI	CTAG	6 cut(s)	68, 93, 321, 648, 1043, 1538
MaeII	ACGT	1 cut(s)	1024
MaeIII	GTNAC	7 cut(s)	98, 303, 1090, 1385, 1409, 1494, 1571
MalI	GATC	2 cut(s)	1057, 1623
MboI	GATC	2 cut(s)	1055, 1621
MboII	GAAGA	5 cut(s)	754, 864, 867, 1259, 1343
MhlI	GDGCHC	1 cut(s)	822
MluCI	AATT	5 cut(s)	417, 1247, 1285, 1499, 1588
MlyI	GAGTC	4 cut(s)	573, 586, 1556, 1688
MmeI	TCCRAC	2 cut(s)	262, 699
Mph1103I	ATGCAT	1 cut(s)	700
MseI	TTAA	2 cut(s)	461, 1242
MslI	CAYNNNNRTG	1 cut(s)	948
Mva1269I	GAATGC	2 cut(s)	1762, 1797
MwoI	GCNNNNNNNGC	2 cut(s)	36, 1480
NdeII	GATC	2 cut(s)	1055, 1621
NmeAIII	GCCGAG	1 cut(s)	105
NmuCI	GTSAC	4 cut(s)	98, 1385, 1409, 1494
NsiI	ATGCAT	1 cut(s)	700
NspI	RCATGY	3 cut(s)	274, 394, 1487
PaeI	GCATGC	1 cut(s)	1487
PciSI	GCTCTTC	1 cut(s)	1356
PctI	GAATGC	2 cut(s)	1762, 1797
PfeI	GAWTC	6 cut(s)	169, 212, 587, 869, 1129, 1391
PflMI	CCANNNNNTGG	1 cut(s)	1328
PkrI	GCNGC	4 cut(s)	529, 862, 1489, 1797
PleI	GAGTC	4 cut(s)	572, 586, 1555, 1688
PpsI	GAGTC	4 cut(s)	572, 586, 1555, 1688
PspPI	GGNCC	4 cut(s)	37, 115, 1319, 1663
RsaI	GTAC	5 cut(s)	404, 686, 830, 1153, 1303
RsaNI	GTAC	5 cut(s)	403, 685, 829, 1152, 1302
RseI	CAYNNNNRTG	1 cut(s)	948
SalI	GTCGAC	1 cut(s)	1549
SapI	GCTCTTC	1 cut(s)	1356
SaqAI	TTAA	2 cut(s)	461, 1242
SatI	GCNGC	4 cut(s)	528, 861, 1488, 1796
Sau3AI	GATC	2 cut(s)	1055, 1621
Sau96I	GGNCC	4 cut(s)	37, 115, 1319, 1663
SchI	GAGTC	4 cut(s)	573, 586, 1556, 1688
SduI	GDGCHC	1 cut(s)	822
SfaNI	GCATC	1 cut(s)	787
SfcI	CTRYAG	1 cut(s)	1602
SinI	GGWCC	2 cut(s)	1319, 1663
SmiMI	CAYNNNNRTG	1 cut(s)	948
SmlI	CTYRAG	4 cut(s)	5, 308, 958, 965
SmoI	CTYRAG	4 cut(s)	5, 308, 958, 965
SphI	GCATGC	1 cut(s)	1487
Sse9I	AATT	5 cut(s)	417, 1247, 1285, 1499, 1588
SsiI	CCGC	1 cut(s)	528
SspI	AATATT	1 cut(s)	354
SspMI	CTAG	6 cut(s)	68, 93, 321, 648, 1043, 1538
StyI	CCWWGG	1 cut(s)	67
TaaI	ACNGT	3 cut(s)	540, 920, 1606
TaiI	ACGT	1 cut(s)	1027
TaqI	TCGA	6 cut(s)	415, 590, 1054, 1110, 1447, 1550
TaqII	GACCGA	1 cut(s)	1428
TasI	AATT	5 cut(s)	417, 1247, 1285, 1499, 1588
TatI	WGTACW	2 cut(s)	684, 1301
TauI	GCSGC	1 cut(s)	530
TfiI	GAWTC	6 cut(s)	169, 212, 587, 869, 1129, 1391
Tru1I	TTAA	2 cut(s)	461, 1242
Tru9I	TTAA	2 cut(s)	461, 1242
TseFI	GTSAC	4 cut(s)	98, 1385, 1409, 1494
TseI	GCWGC	3 cut(s)	860, 1487, 1795
Tsp45I	GTSAC	4 cut(s)	98, 1385, 1409, 1494
TspDTI	ATGAA	4 cut(s)	123, 393, 630, 1630
TspGWI	ACGGA	2 cut(s)	205, 444
Van91I	CCANNNNNTGG	1 cut(s)	1328
VpaK11BI	GGWCC	2 cut(s)	1319, 1663
XapI	RAATTY	3 cut(s)	1247, 1285, 1588
XbaI	TCTAGA	1 cut(s)	92
XceI	RCATGY	3 cut(s)	274, 394, 1487
XmaJI	CCTAGG	1 cut(s)	67
XmiI	GTMKAC	1 cut(s)	1550
XspI	CTAG	6 cut(s)	68, 93, 321, 648, 1043, 1538
Zsp2I	ATGCAT	1 cut(s)	700

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.