Rmu_sc0003465.1_g000004

Arogenate dehydrogenase 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003465.1
OG0003175
Physical Location & Seq
Reverse (-)
29045 .. 31454
2410 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003465.1_g000004.1.cds

Sequence Viewer

Length: 1806 bp
atgctcaagattgccatcattggttttggcaacttgggccaatcccttgccaagacctttgctaacctaggccacatcgtccttgcacattctagatgtgaccactccaaaatggcccaagacctcggcatttcatatttgtctgacccgcaagacctctgtgaacagaatccacaggtcattttgctatgcacctccataatctccacagaatccgtcctcaaatctttacctctccaacgccttaggcatgacacattgtttgttgacatgcttcctgtcaaagagttttcaaaggcattgttactcaagttgttgcctagctattttgatgtcctttgcaccaacccaatgttcggagttgagagaggcaaacaagaatggaatggcatgttttttgtgtatgaaaaggttcgaattgtctctgacagagtggggatttctctctgtgataacctcttaaacatatttgagaaagaagggtgtaggatggtggaagtaagctgttcagagcaggataagtatgccgcaggttcacagtttattacccacgcagttgggagagtcttggggatgttgccattggaatcgactccaataaatacaaaaggttatgaaacattgttggatttggtggacaacacagctagggatagttttgatttatattatgagttgttcatgtacaacaaaaatgcatttgagatgtttgagaggttggacttggcttttgacattttgaagaaacagctttttggttatttgcatgatgttgtgagaaagcaagtatttgataatgcagagaaggtaaaaatggggcacgaggagtacaaggtgtctaacccatctcacaatggagctgcctccgaatcttcttcaaaagctatgaggtcgcataagattgctcaggtatctaaccgtaaagcacagataatatctgaccactttgatgacaactcaaggctcaagattgcaattgttggttttgggaacttcggtcagtttcttgctaaaactattatacgtcaaggtcatatagttctagcctattctcgatcagactactatgatgtggctcaaaagttgggggtaaattacttctctgatgtcgaggaactttgcaaagagcatccagaagtgatacttttttgtacctctattctttcaactgagaaagttctcaggtcatttccagttcagaggttgatgaggaatactttgtttgttgatgttctttctgttaaagaatttccaaaaaacttgtttcttcaaaagttgccattgaattttgatattctctgtactcatcctatgtttggaccagagagtggtaaaaatgggtgggaggctcttccttttgtttatgataaggtcagggtgggaagtgacgaatcaagggtatcactctgtgaccgatttcttgatatctttgctcttgaagggtgtcgaatggttgaaatgtcttgtgcagagcatgataggcatgcagcagggtcacaattccttacgcacacaataggaagggttttggagaagctgggtttggagtcgacacctatctttacaaatggttacaagactttattgaatttggtggagactacagtaggagatagttttgatctttactatggcttgttcatgtataatgtaaatgcaatggaccagctaaatagattggccatggcttttgactcattagaggagcagtttttggggcgtttgcatggtgttgtccataagcaacattctgagaatgcaagcaaaaccttgttgccaaatcatccaagaatgcagctccactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00400 ko01100 ko01110 ko01230 map00400 map01100 map01110 map01230
Pfam Domains
Protein Families
F420_oxidored PDH

Protein Analysis

601

Amino Acids

68.24

Weight (kDa)

6.25

Isoelectric Point (pI)

37.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 521
AccB7I CCANNNNNTGG 1 cut(s) 1328
AccI GTMKAC 1 cut(s) 1550
AciI CCGC 2 cut(s) 149, 528
AcoI YGGCCR 1 cut(s) 1680
AcsI RAATTY 3 cut(s) 1247, 1285, 1588
AdeI CACNNNGTG 1 cut(s) 1409
AfaI GTAC 4 cut(s) 686, 830, 1153, 1303
AfiI CCNNNNNNNGG 3 cut(s) 356, 1316, 1328
AgsI TTSAA 9 cut(s) 294, 742, 879, 1167, 1271, 1285, 1439, 1457, 1588
AjuI GAANNNNNNNTTGG 4 cut(s) 338, 370, 1526, 1558
AluBI AGCT 9 cut(s) 324, 504, 647, 751, 860, 884, 1537, 1669, 1798
AluI AGCT 9 cut(s) 324, 504, 647, 751, 860, 884, 1537, 1669, 1798
Alw26I GTCTC 2 cut(s) 427, 1592
AoxI GGCC 4 cut(s) 37, 70, 114, 1680
ApeKI GCWGC 3 cut(s) 860, 1487, 1795
ApoI RAATTY 3 cut(s) 1247, 1285, 1588
ArsI GACNNNNNNTTYG 4 cut(s) 245, 277, 713, 745
Asp700I GAANNNNTTC 1 cut(s) 411
AspA2I CCTAGG 1 cut(s) 67
AspS9I GGNCC 4 cut(s) 37, 115, 1319, 1663
AsuII TTCGAA 1 cut(s) 415
AvaII GGWCC 2 cut(s) 1319, 1663
AvrII CCTAGG 1 cut(s) 67
AxyI CCTNAGG 1 cut(s) 245
BaeGI GKGCMC 1 cut(s) 822
BalI TGGCCA 1 cut(s) 1682
BauI CACGAG 1 cut(s) 821
BbvI GCAGC 2 cut(s) 847, 1499
BccI CCATC 3 cut(s) 23, 484, 853
BcoDI GTCTC 2 cut(s) 427, 1592
BfaI CTAG 5 cut(s) 68, 93, 321, 648, 1043
BfmI CTRYAG 1 cut(s) 1602
BfuAI ACCTGC 1 cut(s) 521
BisI GCNGC 4 cut(s) 528, 861, 1488, 1796
BlnI CCTAGG 1 cut(s) 67
BlsI GCNGC 4 cut(s) 529, 862, 1489, 1797
Bme18I GGWCC 2 cut(s) 1319, 1663
BmgT120I GGNCC 4 cut(s) 37, 115, 1319, 1663
BmsI GCATC 1 cut(s) 1138
Bpu10I CCTNAGC 1 cut(s) 906
Bpu14I TTCGAA 1 cut(s) 415
BpuEI CTTGAG 3 cut(s) 293, 943, 950
BsaBI GATNNNNATC 1 cut(s) 14
BsaJI CCNNGG 3 cut(s) 67, 124, 1683
Bsc4I CCNNNNNNNGG 3 cut(s) 356, 1316, 1328
Bse1I ACTGG 1 cut(s) 1193
Bse21I CCTNAGG 1 cut(s) 245
Bse3DI GCAATG 1 cut(s) 1665
Bse8I GATNNNNATC 1 cut(s) 14
BseDI CCNNGG 3 cut(s) 67, 124, 1683
BseGI GGATG 5 cut(s) 495, 579, 1129, 1306, 1783
BseJI GATNNNNATC 1 cut(s) 14
BseLI CCNNNNNNNGG 3 cut(s) 356, 1316, 1328
BseMI GCAATG 1 cut(s) 1665
BseMII CTCAG 4 cut(s) 920, 1161, 1195, 1743
BseNI ACTGG 1 cut(s) 1193
BseRI GAGGAG 2 cut(s) 839, 1718
BseSI GKGCMC 1 cut(s) 822
BseXI GCAGC 2 cut(s) 847, 1499
BseYI CCCAGC 1 cut(s) 1537
BsgI GTGCAG 1 cut(s) 1488
BshFI GGCC 4 cut(s) 39, 72, 116, 1682
BslI CCNNNNNNNGG 3 cut(s) 356, 1316, 1328
BsmAI GTCTC 2 cut(s) 427, 1592
BsmI GAATGC 2 cut(s) 1762, 1797
BsnI GGCC 4 cut(s) 39, 72, 116, 1682
Bsp119I TTCGAA 1 cut(s) 415
Bsp1286I GDGCHC 1 cut(s) 822
Bsp1407I TGTACA 1 cut(s) 684
Bsp143I GATC 2 cut(s) 1055, 1621
Bsp19I CCATGG 1 cut(s) 1683
BspACI CCGC 2 cut(s) 149, 528
BspANI GGCC 4 cut(s) 39, 72, 116, 1682
BspCNI CTCAG 4 cut(s) 919, 1162, 1194, 1744
BspMI ACCTGC 1 cut(s) 521
BspQI GCTCTTC 1 cut(s) 1356
BspT104I TTCGAA 1 cut(s) 415
BsrDI GCAATG 1 cut(s) 1665
BsrGI TGTACA 1 cut(s) 684
BsrI ACTGG 1 cut(s) 1193
BssECI CCNNGG 3 cut(s) 67, 124, 1683
BssMI GATC 2 cut(s) 1055, 1621
BssSI CACGAG 1 cut(s) 821
BssT1I CCWWGG 2 cut(s) 67, 1683
Bst2BI CACGAG 1 cut(s) 821
Bst4CI ACNGT 3 cut(s) 540, 920, 1606
Bst6I CTCTTC 1 cut(s) 1356
BstAUI TGTACA 1 cut(s) 684
BstBI TTCGAA 1 cut(s) 415
BstC8I GCNNGC 2 cut(s) 1485, 1762
BstDEI CTNAG 5 cut(s) 245, 906, 1170, 1181, 1752
BstDSI CCRYGG 1 cut(s) 1683
BstF5I GGATG 5 cut(s) 495, 579, 1129, 1306, 1783
BstKTI GATC 2 cut(s) 1058, 1624
BstMAI GTCTC 2 cut(s) 427, 1592
BstMBI GATC 2 cut(s) 1055, 1621
BstMWI GCNNNNNNNGC 2 cut(s) 36, 1480
BstNSI RCATGY 3 cut(s) 274, 394, 1487
BstSFI CTRYAG 1 cut(s) 1602
BstSLI GKGCMC 1 cut(s) 822
BstV1I GCAGC 2 cut(s) 847, 1499
BstXI CCANNNNNNTGG 1 cut(s) 557
Bsu36I CCTNAGG 1 cut(s) 245
BsuRI GGCC 4 cut(s) 39, 72, 116, 1682
BtgI CCRYGG 1 cut(s) 1683
BtsCI GGATG 5 cut(s) 495, 579, 1129, 1306, 1783
BveI ACCTGC 1 cut(s) 521
Cac8I GCNNGC 2 cut(s) 1485, 1762
Cfr13I GGNCC 4 cut(s) 37, 115, 1319, 1663
Csp6I GTAC 4 cut(s) 685, 829, 1152, 1302
CviQI GTAC 4 cut(s) 685, 829, 1152, 1302
DdeI CTNAG 5 cut(s) 245, 906, 1170, 1181, 1752
DpnI GATC 2 cut(s) 1057, 1623
DpnII GATC 2 cut(s) 1055, 1621
DraIII CACNNNGTG 1 cut(s) 1409
EaeI YGGCCR 1 cut(s) 1680
Eam1104I CTCTTC 1 cut(s) 1356
EarI CTCTTC 1 cut(s) 1356
Eco130I CCWWGG 2 cut(s) 67, 1683
Eco32I GATATC 1 cut(s) 1426
Eco47I GGWCC 2 cut(s) 1319, 1663
Eco81I CCTNAGG 1 cut(s) 245
EcoRV GATATC 1 cut(s) 1426
EcoT14I CCWWGG 2 cut(s) 67, 1683
EcoT22I ATGCAT 1 cut(s) 700
ErhI CCWWGG 2 cut(s) 67, 1683
FalI AAGNNNNNCTT 2 cut(s) 1128, 1160
FauI CCCGC 1 cut(s) 156
FblI GTMKAC 1 cut(s) 1550
Fnu4HI GCNGC 4 cut(s) 528, 861, 1488, 1796
FokI GGATG 5 cut(s) 502, 586, 1116, 1293, 1770
Fsp4HI GCNGC 4 cut(s) 528, 861, 1488, 1796
FspBI CTAG 5 cut(s) 68, 93, 321, 648, 1043
GluI GCNGC 4 cut(s) 528, 861, 1488, 1796
GsaI CCCAGC 1 cut(s) 1541
HaeIII GGCC 4 cut(s) 39, 72, 116, 1682
HincII GTYRAC 2 cut(s) 268, 1551
HindII GTYRAC 2 cut(s) 268, 1551
HinfI GANTC 9 cut(s) 169, 212, 564, 587, 592, 869, 1391, 1547, 1694
Hpy166II GTNNAC 5 cut(s) 164, 268, 536, 637, 1551
Hpy188III TCNNGA 7 cut(s) 7, 93, 967, 1053, 1133, 1421, 1436
Hpy8I GTNNAC 5 cut(s) 164, 268, 536, 637, 1551
HpyAV CCTTC 4 cut(s) 473, 799, 1433, 1515
HpyCH4III ACNGT 3 cut(s) 540, 920, 1606
HpyCH4IV ACGT 1 cut(s) 1024
HpyF10VI GCNNNNNNNGC 2 cut(s) 36, 1480
HpyF3I CTNAG 5 cut(s) 245, 906, 1170, 1181, 1752
HpySE526I ACGT 1 cut(s) 1024
Kzo9I GATC 2 cut(s) 1055, 1621
LguI GCTCTTC 1 cut(s) 1356
LmnI GCTCC 3 cut(s) 857, 1705, 1803
Lsp1109I GCAGC 2 cut(s) 847, 1499
LweI GCATC 1 cut(s) 1138
MaeI CTAG 5 cut(s) 68, 93, 321, 648, 1043
MaeII ACGT 1 cut(s) 1024
MaeIII GTNAC 6 cut(s) 98, 303, 1385, 1409, 1494, 1571
MalI GATC 2 cut(s) 1057, 1623
MboI GATC 2 cut(s) 1055, 1621
MboII GAAGA 5 cut(s) 754, 864, 867, 1259, 1343
MfeI CAATTG 1 cut(s) 975
MhlI GDGCHC 1 cut(s) 822
MlsI TGGCCA 1 cut(s) 1682
MluCI AATT 7 cut(s) 417, 975, 1093, 1247, 1285, 1499, 1588
MluNI TGGCCA 1 cut(s) 1682
MlyI GAGTC 4 cut(s) 573, 586, 1556, 1688
MmeI TCCRAC 3 cut(s) 262, 606, 699
Mox20I TGGCCA 1 cut(s) 1682
Mph1103I ATGCAT 1 cut(s) 700
MroXI GAANNNNTTC 1 cut(s) 411
MscI TGGCCA 1 cut(s) 1682
MseI TTAA 2 cut(s) 461, 1242
MslI CAYNNNNRTG 1 cut(s) 948
Msp20I TGGCCA 1 cut(s) 1682
MunI CAATTG 1 cut(s) 975
Mva1269I GAATGC 2 cut(s) 1762, 1797
MwoI GCNNNNNNNGC 2 cut(s) 36, 1480
NcoI CCATGG 1 cut(s) 1683
NdeII GATC 2 cut(s) 1055, 1621
NmeAIII GCCGAG 1 cut(s) 105
NmuCI GTSAC 4 cut(s) 98, 1385, 1409, 1494
NsiI ATGCAT 1 cut(s) 700
NspI RCATGY 3 cut(s) 274, 394, 1487
NspV TTCGAA 1 cut(s) 415
PaeI GCATGC 1 cut(s) 1487
PciSI GCTCTTC 1 cut(s) 1356
PctI GAATGC 2 cut(s) 1762, 1797
PdmI GAANNNNTTC 1 cut(s) 411
PfeI GAWTC 5 cut(s) 169, 212, 587, 869, 1391
PflMI CCANNNNNTGG 1 cut(s) 1328
PkrI GCNGC 4 cut(s) 529, 862, 1489, 1797
PleI GAGTC 4 cut(s) 572, 586, 1555, 1688
PpsI GAGTC 4 cut(s) 572, 586, 1555, 1688
PspFI CCCAGC 1 cut(s) 1537
PspPI GGNCC 4 cut(s) 37, 115, 1319, 1663
RsaI GTAC 4 cut(s) 686, 830, 1153, 1303
RsaNI GTAC 4 cut(s) 685, 829, 1152, 1302
RseI CAYNNNNRTG 1 cut(s) 948
SalI GTCGAC 1 cut(s) 1549
SapI GCTCTTC 1 cut(s) 1356
SaqAI TTAA 2 cut(s) 461, 1242
SatI GCNGC 4 cut(s) 528, 861, 1488, 1796
Sau3AI GATC 2 cut(s) 1055, 1621
Sau96I GGNCC 4 cut(s) 37, 115, 1319, 1663
SchI GAGTC 4 cut(s) 573, 586, 1556, 1688
SduI GDGCHC 1 cut(s) 822
SfaNI GCATC 1 cut(s) 1138
SfcI CTRYAG 1 cut(s) 1602
SfuI TTCGAA 1 cut(s) 415
SinI GGWCC 2 cut(s) 1319, 1663
SmiMI CAYNNNNRTG 1 cut(s) 948
SmlI CTYRAG 4 cut(s) 5, 308, 958, 965
SmoI CTYRAG 4 cut(s) 5, 308, 958, 965
SphI GCATGC 1 cut(s) 1487
Sse9I AATT 7 cut(s) 417, 975, 1093, 1247, 1285, 1499, 1588
SsiI CCGC 2 cut(s) 149, 528
SspMI CTAG 5 cut(s) 68, 93, 321, 648, 1043
StyI CCWWGG 2 cut(s) 67, 1683
TaaI ACNGT 3 cut(s) 540, 920, 1606
TaiI ACGT 1 cut(s) 1027
TaqI TCGA 6 cut(s) 415, 590, 1054, 1110, 1447, 1550
TaqII GACCGA 2 cut(s) 986, 1428
TasI AATT 7 cut(s) 417, 975, 1093, 1247, 1285, 1499, 1588
TatI WGTACW 3 cut(s) 684, 828, 1301
TauI GCSGC 1 cut(s) 530
TfiI GAWTC 5 cut(s) 169, 212, 587, 869, 1391
Tru1I TTAA 2 cut(s) 461, 1242
Tru9I TTAA 2 cut(s) 461, 1242
TseFI GTSAC 4 cut(s) 98, 1385, 1409, 1494
TseI GCWGC 3 cut(s) 860, 1487, 1795
Tsp45I GTSAC 4 cut(s) 98, 1385, 1409, 1494
TspDTI ATGAA 5 cut(s) 123, 420, 630, 670, 1630
TspGWI ACGGA 1 cut(s) 205
Van91I CCANNNNNTGG 1 cut(s) 1328
VpaK11BI GGWCC 2 cut(s) 1319, 1663
XapI RAATTY 3 cut(s) 1247, 1285, 1588
XbaI TCTAGA 1 cut(s) 92
XceI RCATGY 3 cut(s) 274, 394, 1487
XmaJI CCTAGG 1 cut(s) 67
XmiI GTMKAC 1 cut(s) 1550
XmnI GAANNNNTTC 1 cut(s) 411
XspI CTAG 5 cut(s) 68, 93, 321, 648, 1043
Zsp2I ATGCAT 1 cut(s) 700
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.