Rmu_sc0000031.1_g000030

iron import into the mitochondrion

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000031.1
OG0013020
Physical Location & Seq
Reverse (-)
157360 .. 157817
458 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000031.1_g000030.1.cds

Sequence Viewer

Length: 396 bp
atgtgttttgcagctgtagaaacccacaacggaagcgattcaaacaccaacatcgacgacgatgatgtcgccgagttctaccgcgtgattgtgaaccagaagcagaggggagtgtcgtcgatcagattaaacgacgacgtcgagggtgataatggcagcagtagtgaagaagaagaagaagagatcggagggggttatgattcggcgatcgcgagggcaatcagagaagacgagggtcgccagcatgagctgttgacgctggagaatgcgacgatggttatagaggtgatgaaagggatttcgtttgatggagtggaaccggattgggtggatcggatccctgaagagaacttgatcgatcggcttcgccggctttggcaggctccccagatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.75

Weight (kDa)

4.19

Isoelectric Point (pI)

55.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013020)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G07020
fragaria_vesca FvH4_3g21494 FvH4_3g39700 FvH4_3g39700
malus_domestica MD03G1055700.v1.1
prunus_persica Prupe.6G049000_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0071561
rosa_laevigata RLG00000013433 RLG00000036225
rosa_multiflora Rmu_sc0000031.1_g000030 Rmu_sc0005745.1_g000008
rosa_roxburghii Rroxscaffold_1G00009610
rosa_rugosa Rorug05G0413200
rosa_samantha Rh5AG469100 Rh5BG488300 Rh5DG499100
rosa_wichuraiana Rw5G043590 Rw6G041020

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 65
AatII GACGTC 1 cut(s) 141
AccII CGCG 2 cut(s) 84, 212
AciI CCGC 1 cut(s) 82
AclWI GGATC 3 cut(s) 331, 339, 344
AcuI CTGAAG 1 cut(s) 363
AcyI GRCGYC 1 cut(s) 138
AgsI TTSAA 1 cut(s) 42
AluBI AGCT 2 cut(s) 14, 250
AluI AGCT 2 cut(s) 14, 250
AlwI GGATC 3 cut(s) 331, 339, 344
ApeKI GCWGC 2 cut(s) 11, 156
AsiSI GCGATCGC 1 cut(s) 210
Asp700I GAANNNNTTC 1 cut(s) 37
AsuHPI GGTGA 2 cut(s) 158, 298
BamHI GGATCC 1 cut(s) 336
BbsI GAAGAC 1 cut(s) 234
BbvI GCAGC 2 cut(s) 23, 168
BccI CCATC 2 cut(s) 268, 302
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 2 cut(s) 12, 157
BlsI GCNGC 2 cut(s) 13, 158
BmiI GGNNCC 3 cut(s) 318, 338, 384
BoxI GACNNNNGTC 1 cut(s) 234
BpiI GAAGAC 1 cut(s) 234
BpmI CTGGAG 1 cut(s) 281
Bsa29I ATCGAT 1 cut(s) 357
BsaHI GRCGYC 1 cut(s) 138
BsaWI WCCGGW 1 cut(s) 319
Bse118I RCCGGY 1 cut(s) 369
BseCI ATCGAT 1 cut(s) 357
BseXI GCAGC 2 cut(s) 23, 168
Bsh1236I CGCG 2 cut(s) 84, 212
Bsh1285I CGRYCG 2 cut(s) 210, 361
BshVI ATCGAT 1 cut(s) 357
BsiEI CGRYCG 2 cut(s) 210, 361
BsiSI CCGG 2 cut(s) 320, 370
BsmI GAATGC 1 cut(s) 271
Bsp143I GATC 7 cut(s) 120, 183, 207, 331, 336, 354, 358
Bsp68I TCGCGA 1 cut(s) 212
BspACI CCGC 1 cut(s) 82
BspDI ATCGAT 1 cut(s) 357
BspFNI CGCG 2 cut(s) 84, 212
BspLI GGNNCC 3 cut(s) 318, 338, 384
BspPI GGATC 3 cut(s) 331, 339, 344
BsrFI RCCGGY 1 cut(s) 369
BssAI RCCGGY 1 cut(s) 369
BssMI GATC 7 cut(s) 120, 183, 207, 331, 336, 354, 358
BssNI GRCGYC 1 cut(s) 138
Bst6I CTCTTC 2 cut(s) 174, 339
BstACI GRCGYC 1 cut(s) 138
BstC8I GCNNGC 3 cut(s) 242, 371, 381
BstFNI CGCG 2 cut(s) 84, 212
BstKTI GATC 7 cut(s) 123, 186, 210, 334, 339, 357, 361
BstMBI GATC 7 cut(s) 120, 183, 207, 331, 336, 354, 358
BstMCI CGRYCG 2 cut(s) 210, 361
BstMWI GCNNNNNNNGC 2 cut(s) 256, 370
BstPAI GACNNNNGTC 1 cut(s) 234
BstSFI CTRYAG 1 cut(s) 15
BstUI CGCG 2 cut(s) 84, 212
BstV1I GCAGC 2 cut(s) 23, 168
BstV2I GAAGAC 1 cut(s) 234
BstX2I RGATCY 1 cut(s) 336
BstYI RGATCY 1 cut(s) 336
Bsu15I ATCGAT 1 cut(s) 357
BsuTUI ATCGAT 1 cut(s) 357
BtuMI TCGCGA 1 cut(s) 212
Cac8I GCNNGC 3 cut(s) 242, 371, 381
Cfr10I RCCGGY 1 cut(s) 369
ClaI ATCGAT 1 cut(s) 357
CseI GACGC 1 cut(s) 265
CviAII CATG 1 cut(s) 245
CviJI RGCY 5 cut(s) 14, 250, 364, 373, 383
CviKI_1 RGCY 5 cut(s) 14, 250, 364, 373, 383
DpnI GATC 7 cut(s) 122, 185, 209, 333, 338, 356, 360
DpnII GATC 7 cut(s) 120, 183, 207, 331, 336, 354, 358
DrdI GACNNNNNNGTC 1 cut(s) 65
DseDI GACNNNNNNGTC 1 cut(s) 65
Eam1104I CTCTTC 2 cut(s) 174, 339
EarI CTCTTC 2 cut(s) 174, 339
Eco57I CTGAAG 1 cut(s) 363
FaeI CATG 1 cut(s) 248
FaiI YATR 3 cut(s) 198, 246, 281
FatI CATG 1 cut(s) 244
Fnu4HI GCNGC 2 cut(s) 12, 157
Fsp4HI GCNGC 2 cut(s) 12, 157
GluI GCNGC 2 cut(s) 12, 157
GsuI CTGGAG 1 cut(s) 281
HapII CCGG 2 cut(s) 320, 370
HgaI GACGC 1 cut(s) 265
Hin1I GRCGYC 1 cut(s) 138
Hin1II CATG 1 cut(s) 248
HincII GTYRAC 1 cut(s) 255
HindII GTYRAC 1 cut(s) 255
HinfI GANTC 2 cut(s) 38, 200
HpaII CCGG 2 cut(s) 320, 370
HphI GGTGA 2 cut(s) 158, 298
Hpy166II GTNNAC 2 cut(s) 94, 255
Hpy188I TCNGA 4 cut(s) 125, 188, 224, 336
Hpy188III TCNNGA 1 cut(s) 211
Hpy8I GTNNAC 2 cut(s) 94, 255
Hpy99I CGWCG 7 cut(s) 59, 62, 121, 137, 140, 143, 274
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 2 cut(s) 256, 370
HpySE526I ACGT 1 cut(s) 138
Hsp92I GRCGYC 1 cut(s) 138
Hsp92II CATG 1 cut(s) 248
KroI GCCGGC 1 cut(s) 369
KroNI GCCGGC 1 cut(s) 371
Kzo9I GATC 7 cut(s) 120, 183, 207, 331, 336, 354, 358
LmnI GCTCC 1 cut(s) 388
LpnPI CCDG 7 cut(s) 110, 245, 254, 333, 354, 365, 383
Lsp1109I GCAGC 2 cut(s) 23, 168
MaeII ACGT 1 cut(s) 138
MalI GATC 7 cut(s) 122, 185, 209, 333, 338, 356, 360
MboI GATC 7 cut(s) 120, 183, 207, 331, 336, 354, 358
MboII GAAGA 7 cut(s) 179, 182, 185, 188, 191, 239, 356
MflI RGATCY 1 cut(s) 336
MnlI CCTC 6 cut(s) 99, 136, 182, 207, 226, 277
MroNI GCCGGC 1 cut(s) 369
MroXI GAANNNNTTC 1 cut(s) 37
MseI TTAA 2 cut(s) 128, 394
MspA1I CMGCKG 1 cut(s) 14
MspI CCGG 2 cut(s) 320, 370
Mva1269I GAATGC 1 cut(s) 271
MvnI CGCG 2 cut(s) 84, 212
MwoI GCNNNNNNNGC 2 cut(s) 256, 370
NaeI GCCGGC 1 cut(s) 371
NdeII GATC 7 cut(s) 120, 183, 207, 331, 336, 354, 358
NgoMIV GCCGGC 1 cut(s) 369
NlaIII CATG 1 cut(s) 248
NlaIV GGNNCC 3 cut(s) 318, 338, 384
NmeAIII GCCGAG 1 cut(s) 97
NruI TCGCGA 1 cut(s) 212
PcsI WCGNNNNNNNCGW 2 cut(s) 138, 209
PctI GAATGC 1 cut(s) 271
PdiI GCCGGC 1 cut(s) 371
PdmI GAANNNNTTC 1 cut(s) 37
PfeI GAWTC 2 cut(s) 38, 200
PflFI GACNNNGTC 1 cut(s) 137
PkrI GCNGC 2 cut(s) 13, 158
Ple19I CGATCG 2 cut(s) 210, 361
PshAI GACNNNNGTC 1 cut(s) 234
PspN4I GGNNCC 3 cut(s) 318, 338, 384
PsuI RGATCY 1 cut(s) 336
PsyI GACNNNGTC 1 cut(s) 137
PvuI CGATCG 2 cut(s) 210, 361
PvuII CAGCTG 1 cut(s) 14
RgaI GCGATCGC 1 cut(s) 210
RruI TCGCGA 1 cut(s) 212
SaqAI TTAA 2 cut(s) 128, 394
SatI GCNGC 2 cut(s) 12, 157
Sau3AI GATC 7 cut(s) 120, 183, 207, 331, 336, 354, 358
SetI ASST 4 cut(s) 16, 141, 252, 288
SfaAI GCGATCGC 1 cut(s) 210
SfcI CTRYAG 1 cut(s) 15
SgfI GCGATCGC 1 cut(s) 210
SsiI CCGC 1 cut(s) 82
TaiI ACGT 1 cut(s) 141
TaqI TCGA 4 cut(s) 54, 119, 141, 357
TfiI GAWTC 2 cut(s) 38, 200
Tru1I TTAA 2 cut(s) 128, 394
Tru9I TTAA 2 cut(s) 128, 394
TseI GCWGC 2 cut(s) 11, 156
TspDTI ATGAA 1 cut(s) 305
TspGWI ACGGA 1 cut(s) 45
Tth111I GACNNNGTC 1 cut(s) 137
XmnI GAANNNNTTC 1 cut(s) 37
ZraI GACGTC 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.