Rmu_sc0000035.1_g000031

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000035.1
OG0007084
Physical Location & Seq
Reverse (-)
110110 .. 111309
1200 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000035.1_g000031.1.cds

Sequence Viewer

Length: 264 bp
atggacacccaaaacccttgtgactttagcacgcaccacgttttgggccacccatttgagttaggccttaaaaaagatgaggaatcccttgaacatgtatcaccagaagatctgttaaaaagacatgtcaaacgtgctagaaaggttcgagcacgattaagagaagaacgtttacggcgcattgcaaggtacaagtctaggcttgctcttctccttcctccactggtagaacagttccgaaatgatctagctgctggaaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LIN37

Protein Analysis

87

Amino Acids

10.22

Weight (kDa)

9.88

Isoelectric Point (pI)

52.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 43
AclI AACGTT 1 cut(s) 169
AfaI GTAC 1 cut(s) 191
AfiI CCNNNNNNNGG 1 cut(s) 43
AflIII ACRYGT 2 cut(s) 94, 124
AgsI TTSAA 1 cut(s) 92
AluBI AGCT 1 cut(s) 251
AluI AGCT 1 cut(s) 251
Alw21I GWGCWC 1 cut(s) 154
AoxI GGCC 2 cut(s) 46, 64
ApeKI GCWGC 1 cut(s) 251
AspLEI GCGC 1 cut(s) 180
AspS9I GGNCC 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 93
BarI GAAGNNNNNNTAC 2 cut(s) 156, 188
Bbv12I GWGCWC 1 cut(s) 154
BbvI GCAGC 1 cut(s) 238
BceAI ACGGC 1 cut(s) 191
BfaI CTAG 3 cut(s) 138, 198, 248
BglII AGATCT 1 cut(s) 109
BisI GCNGC 1 cut(s) 252
BlsI GCNGC 1 cut(s) 253
BmgT120I GGNCC 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 228
Bse3DI GCAATG 1 cut(s) 180
BseLI CCNNNNNNNGG 1 cut(s) 43
BseMI GCAATG 1 cut(s) 180
BseNI ACTGG 1 cut(s) 228
BseXI GCAGC 1 cut(s) 238
BshFI GGCC 2 cut(s) 48, 66
BsiHKAI GWGCWC 1 cut(s) 154
BslI CCNNNNNNNGG 1 cut(s) 43
BsnI GGCC 2 cut(s) 48, 66
Bsp1286I GDGCHC 1 cut(s) 154
Bsp143I GATC 2 cut(s) 109, 244
BspANI GGCC 2 cut(s) 48, 66
BspQI GCTCTTC 1 cut(s) 213
BsrDI GCAATG 1 cut(s) 180
BsrI ACTGG 1 cut(s) 228
BssMI GATC 2 cut(s) 109, 244
Bst4CI ACNGT 1 cut(s) 234
Bst6I CTCTTC 1 cut(s) 213
BstC8I GCNNGC 2 cut(s) 32, 204
BstHHI GCGC 1 cut(s) 180
BstKTI GATC 2 cut(s) 112, 247
BstMBI GATC 2 cut(s) 109, 244
BstNSI RCATGY 2 cut(s) 98, 128
BstV1I GCAGC 1 cut(s) 238
BstX2I RGATCY 1 cut(s) 109
BstYI RGATCY 1 cut(s) 109
BsuRI GGCC 2 cut(s) 48, 66
BtsIMutI CAGTG 1 cut(s) 221
Cac8I GCNNGC 2 cut(s) 32, 204
CfoI GCGC 1 cut(s) 180
Cfr13I GGNCC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 190
CviAII CATG 2 cut(s) 95, 125
CviJI RGCY 4 cut(s) 48, 66, 202, 251
CviKI_1 RGCY 4 cut(s) 48, 66, 202, 251
CviQI GTAC 1 cut(s) 190
DpnI GATC 2 cut(s) 111, 246
DpnII GATC 2 cut(s) 109, 244
Eam1104I CTCTTC 1 cut(s) 213
EarI CTCTTC 1 cut(s) 213
Eco147I AGGCCT 1 cut(s) 66
FaeI CATG 2 cut(s) 98, 128
FaiI YATR 2 cut(s) 96, 126
FatI CATG 2 cut(s) 94, 124
Fnu4HI GCNGC 1 cut(s) 252
Fsp4HI GCNGC 1 cut(s) 252
FspBI CTAG 3 cut(s) 138, 198, 248
GlaI GCGC 1 cut(s) 179
GluI GCNGC 1 cut(s) 252
HaeIII GGCC 2 cut(s) 48, 66
HhaI GCGC 1 cut(s) 180
Hin1II CATG 2 cut(s) 98, 128
Hin6I GCGC 1 cut(s) 178
HinP1I GCGC 1 cut(s) 178
HinfI GANTC 1 cut(s) 83
HphI GGTGA 1 cut(s) 93
Hpy166II GTNNAC 1 cut(s) 173
Hpy188I TCNGA 1 cut(s) 239
Hpy8I GTNNAC 1 cut(s) 173
HpyAV CCTTC 1 cut(s) 224
HpyCH4III ACNGT 1 cut(s) 234
HpyCH4IV ACGT 3 cut(s) 39, 133, 169
HpyCH4V TGCA 1 cut(s) 185
HpySE526I ACGT 3 cut(s) 39, 133, 169
Hsp92II CATG 2 cut(s) 98, 128
HspAI GCGC 1 cut(s) 178
Kzo9I GATC 2 cut(s) 109, 244
LguI GCTCTTC 1 cut(s) 213
LpnPI CCDG 3 cut(s) 117, 209, 240
Lsp1109I GCAGC 1 cut(s) 238
MaeI CTAG 3 cut(s) 138, 198, 248
MaeII ACGT 3 cut(s) 39, 133, 169
MaeIII GTNAC 1 cut(s) 20
MalI GATC 2 cut(s) 111, 246
MboI GATC 2 cut(s) 109, 244
MboII GAAGA 3 cut(s) 119, 176, 200
MflI RGATCY 1 cut(s) 109
MhlI GDGCHC 1 cut(s) 154
MluCI AATT 1 cut(s) 259
MnlI CCTC 2 cut(s) 73, 228
MseI TTAA 3 cut(s) 69, 116, 158
NdeII GATC 2 cut(s) 109, 244
NlaIII CATG 2 cut(s) 98, 128
NmuCI GTSAC 1 cut(s) 20
NspI RCATGY 2 cut(s) 98, 128
PceI AGGCCT 1 cut(s) 66
PciI ACATGT 2 cut(s) 94, 124
PciSI GCTCTTC 1 cut(s) 213
PfeI GAWTC 1 cut(s) 83
PflMI CCANNNNNTGG 1 cut(s) 43
PkrI GCNGC 1 cut(s) 253
PscI ACATGT 2 cut(s) 94, 124
Psp1406I AACGTT 1 cut(s) 169
PspPI GGNCC 1 cut(s) 46
PsuI RGATCY 1 cut(s) 109
RsaI GTAC 1 cut(s) 191
RsaNI GTAC 1 cut(s) 190
SapI GCTCTTC 1 cut(s) 213
SaqAI TTAA 3 cut(s) 69, 116, 158
SatI GCNGC 1 cut(s) 252
Sau3AI GATC 2 cut(s) 109, 244
Sau96I GGNCC 1 cut(s) 46
SduI GDGCHC 1 cut(s) 154
SetI ASST 6 cut(s) 42, 136, 147, 172, 191, 253
Sse9I AATT 1 cut(s) 259
SseBI AGGCCT 1 cut(s) 66
SspMI CTAG 3 cut(s) 138, 198, 248
StuI AGGCCT 1 cut(s) 66
TaaI ACNGT 1 cut(s) 234
TaiI ACGT 3 cut(s) 42, 136, 172
TaqI TCGA 1 cut(s) 148
TasI AATT 1 cut(s) 259
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 3 cut(s) 69, 116, 158
Tru9I TTAA 3 cut(s) 69, 116, 158
TscAI CASTG 1 cut(s) 228
TseFI GTSAC 1 cut(s) 20
TseI GCWGC 1 cut(s) 251
Tsp45I GTSAC 1 cut(s) 20
TspRI CASTG 1 cut(s) 228
Van91I CCANNNNNTGG 1 cut(s) 43
XceI RCATGY 2 cut(s) 98, 128
XspI CTAG 3 cut(s) 138, 198, 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.