Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000043.1

Orthogroup ID

OG0002658

Physical Location & Seq

Genomic Coordinates Reverse (-)

70450 .. 81719

Gene Structure 11270 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000043.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 5304 bp

atgaaagaggggttgagatctggcaagtttaaggttgagaaagaaaagggttctttgaagcaaacagtggtgggaaacaaaggggatgaggaaaccccacatttggttttggacggtgggcatggaccggaatttgatcatgtgcttcagactgggaatggtggtggtgttgttgacaggaaaaaggtgaatggtcaagtgccaattgttggcagggttctgcggtcacgggttgtggcgaatggtggtgttgaggtagtaggggagactgggaagaagaggaggttggtggctaatggggatgataagaacgggaaggaagaaaaggtgggaggtcaagtggggattgctggtagggttttgcggtcgcggactgtggtgaatggtggggagatggaggatgtgggagttgcggagaaaaggaagaggcagaggaagttgaaaggtaagcgtgggagaccacccaaggtgagaaaagaagaaagtgggaggtcgggtgatggactcaggaagttgaaaggtaagcgtgggagaccacccaaggtgagaaaagaagaaagtgggaggtcgggtgatggactcaggaagttgaaaggtaagcgtgggagaccacccaaggtgagaaaagaagaaagtgggaggtcgggtgatggactcaggaagttgaaaggtaagcgtgggagaccacccaaggtgagaaaagaagaaagtgggaggtcgggtgatggactcaggaagttgaaaggtaagcgtgggagaccacccaaggtgagaaaagaagaaagtgggaggtcgggtgatggactcaggaagttgaaaggtaagcgtgggagaccacccaaggtgagaaaagaagaaagtgggaggtcgggtgatggactcaggaagttgaaaggtaagcgtgggagaccacccaaggtgagaaaagaagaaagtgggaggtcgggtgatggactcaggaagttgaaaggtaagcgtgggagaccacccaaggtgagaaaagaagaaagtgggaggtcgggtgatggactcaggaagttgaaaggtaagcgtgggagaccggtgaaaaaagaaagagaagagagtgatctcttggatggtcggctgagaaagaagttaagatctgggcagaatagtagtgagaatttgaaaggaaatcttgacgaggaaggaaatgtgtacttcaaaagaaaatcgggttcaaagtcacaagaaagagtgaaaccaagtacagtaactaatgattcatacctggaaaggaagaggattaggaaagaattggatgtaaaggcctcttctcaagttaaaagggataaaaaaggaagatatgtggagagtgaggacagtgaggatggggatgaacataaagcacagaaacaaaaacaaagcggagataataaacagagaagcaagtcgaaggatggcatacgtgagctaaaacagtcggtgagtgaaaaaatagtgaaaatgattctggctgcaggctggacggttgagcgtaggcagaggaatggcagagagtacatggatgcagtgtatgtatgtccagcaggaaagactcactggtcagtaaccaaggcttacaatgcttttaaagtaggttgtgaaaatggcgatccaatgacttgtaaggacagtttcaactttacgccgataccaccagaggaactcagcatgctacataggatagttaataaaaaggtggggaaatataagaagaagaagaagggaaagggtaaacgacagggaaacagtaatggaaagcagaaggcaaaggatggggatgtatcggatgaaggtattgaagagaagaggaaaaagaaactgggtaagtcactgaaatggaaacatttgcttcttgagaaggatgcatcaacaagtacagcatgcgagggagagctgcgtttggtccagcgtcagaagcggcagaagactcagcatagaaagcgatgtgctttgttagttcgcaactctgagaatgcggattctgaaaatgatggctacataccatatgatgggaagagaacagtacttgcctggatggttgacttgggaaccctgtcacttaattcaaagttgaagtacatgaacaagaggaagagaaaagtgctgcgtgagggtaaaattgcaagagatggaattcattgtggttgctgtgacaaaatgatctcactttcagaatttgtaactcatactggaagtgattattctgagcctcttagatatatattgacagactctgggtcttcccttttgcaatgcctgctaaactcatggaataaacaggaagagtctgaacgtcggggattccactttgtagaggttactaaggaagacccaaatgatgatacatgtgggatctgtggagatggaggagatttgatctgttgtgacggttgtccatcaacattccataaaagttgcttggagataaagaagttcccatctggtgactggcactgtgtatactgctcatgcaaattctgtgggatgtttgatgagaatatgtgtcaaggggacagtagtgagaatgtagttgcgtcagcattacttacctgccatttgtgtgaggaaaaatatcatcgatgctgtattcaggcaaaggatgctgtaaatggtgattccagcagtccatccttctgcgcaaagaattgccaagagctatttgtgaaactggagaggcttcttggagttagacatgaagtggaagaagggttttcattgactctccttcgccgatttgatgtgggtgatacaccacagaaggttgattgcaactcaaagctaattgaatgcaatgccaaactggctgttgcatttttaataatggatgagtgttttctgcctatggttgaccacagaagtggagtcaatctgatccataacattctctataatcgtgggtcaaattttaaccgtctgaattatggtggtttcttcactgcaattctagagaggggtgatgagatcatatctgccgcaaccatcagaatccatggaaactatctagcagagatgccgtttattggaacccgctatatgtataggcgtcaaggaatgtgccgccggcttctaagtgcgattgaatctgctctctgctctctgaaagttgaaagattggtcatacctgcaatctcagaactgacggaaacgtggacttctgtttttggttttaagtcccttgaagaatcaagtaagcagaagatgaagaacatgaatatcttggttttccctggtgtagatatcttacagaaaccattgttgaaccagttaacagaaaaaaacgagagtcctgtgaaaggtttgagttttgccgatctcgagcatctcaaaaccattaaggatgtggtatgtaatactgaagagggacgtttggctcgatctgacagtgaagcaactgcaccttgtgtgcatgaaggaaatgatgagcttgctgctgttcaatccaacacacagcttctctgtgatgtttctcatgataatctggagagcaagaccaatactatcccaattcctactgattcagtgtgtgatgttcttgaaccaaccaaagagataaatgaatgccaaaattctgcctctgttgctgatgtgagggcattggaattggtcaccaaacagaaccagccggagctgttatgcaatactgctgagggtttcttggctggatcagatgctgaggcaactgcatcctttaaacacaaggcaaatgatgaacttgttgctgttcaatctgatacacagcttccttctggtgtttcacatgataatgtggagggggaaaacaattctatgacaattcctactggtccaattagtgatgctcatgaacaaactgaagatacacagcttctttgtggtgtttctcatgataaccgggaggtaaacaatactctgacaattcctactggttcaattagtgacggtcatgaacaaactgaagagagaaatgaacgtcaaaattcagactctgttcctgatgttaaggaagtggaattgggcaccaaacagaaccaatatagcatgtctaaagtggaaaggaaatctgatcttcatcctgaaggtattgattctgctatagaagttcgttgtgctttaggggagggtactgaaaacattgaccgtaagaatgtctctttagttcatgaagccaacgtttccagtgaaaatattgttcgcactggttcagagattacaactcagatatctcatgatgcaagggaccataggcattatgattctcaacatctgcaggttgaaggatctattttccattcagatgaaaagctgcttgagacttttgaagtggagaataaccattcttttattcagcacacttctatagtgactgaaggggtgcatccagaatctatcaagtgttccgactctagaattctgaccaaaactggcaaggtagccagtgatggatttcaccaggctgctgcgttgactcatgaagaagcagatgattctaaaggtcattctacaactttgctgtttggtagcagcattatttgtacctctggcaatgggaagaacactcacaaagttgtctcaactccagctgacaacaattctcatccttcttgtggggctaatatcaatagtaatgggaattccaatgcccctgatgtccctggtgtctactttacttcccatggcgctcatatgagcaccaagtccttgcagcaatctggttttgattctgatattgataataacagtatcagacagcccaactcgagcaatacatgtgcatctggtggggggttttctacttccgccttcaagctctctcacacaggcaaggagctgctcagagcctcaagatccaaaaccctagccatgtcgctcgttgccaacgaagaattccagcacattctgcgtgtgctcaacaccaacgtcgatgggaagcagaagatcatgtttgccatgacctccatcaaaggtattggccgccgtttggccaatatcgtctgcaaaaaggccgatgtcgacatgaacaagagagctggtgaactatctgctgctgagattgataatctcatgacaattgttgggaatcctcgccagttcaaaattccagattggtttttgaacaggaagaaggattacaaggatggcaggtattcccaagttgttgccaatgctttggacatgaagctgagagatgatctcgagcggttgaagaagatcaggaaccaccgtggtcttcgtcactactggggccttcgggtacgtgggcagcacacaaagactactggtcgcaggggaaagaccgttggtgtctccaagaagcgataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000122 GO:0003674 GO:0003824 GO:0004842 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0006355 GO:0006357 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009889 GO:0009890 GO:0009892 GO:0009966 GO:0009968 GO:0009987 GO:0010468 GO:0010556 GO:0010558 GO:0010605 GO:0010629 GO:0010646 GO:0010648 GO:0016567 GO:0016740 GO:0017015 GO:0019219 GO:0019222 GO:0019538 GO:0019787 GO:0023051 GO:0023057 GO:0030510 GO:0030514 GO:0031323 GO:0031324 GO:0031326 GO:0031327 GO:0031974 GO:0031981 GO:0032446 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0045892 GO:0045934 GO:0046332 GO:0048519 GO:0048523 GO:0048583 GO:0048585 GO:0050789 GO:0050794 GO:0051171 GO:0051172 GO:0051252 GO:0051253 GO:0060255 GO:0065007 GO:0070013 GO:0070410 GO:0070412 GO:0070647 GO:0071704 GO:0080090 GO:0090092 GO:0090101 GO:0090287 GO:0090288 GO:0140096 GO:1901564 GO:1902679 GO:1903506 GO:1903507 GO:1903844 GO:2000112 GO:2000113 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AT_hook Jas PHD

Protein Analysis

1767

Amino Acids

196.25

Weight (kDa)

9.43

Isoelectric Point (pI)

44.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002658)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G36670 AT5G36670 AT5G36670 AT5G36670 AT5G36670 AT5G36740 AT5G36740 AT5G36740 AT5G36740 AT5G36740
fragaria_vesca	FvH4_2g23330 FvH4_2g23330 FvH4_2g23330 FvH4_2g23330 FvH4_2g23330 FvH4_2g23330 FvH4_2g23330 FvH4_2g23330 FvH4_2g23330 FvH4_2g23330 FvH4_2g23330
malus_domestica	MD03G1262700.v1.1 MD11G1283400.v1.1
prunus_persica	Prupe.8G239000_v2.0.a1
pyrus_communis	pycom03g21020 pycom11g25090
rosa_chinensis	RchiOBHm_Chr6g0290741 RchiOBHm_Chr6g0290751
rosa_laevigata	RLG00000012182
rosa_multiflora	Rmu_co8421285.1_g000001 Rmu_sc0000043.1_g000020
rosa_roxburghii	Rroxscaffold_7G00176760
rosa_rugosa	Rorug06G0214400 Rorug06G0214500 Rorug06G0214600
rosa_samantha	Rh6AG325000 Rh6BG332600 Rh6CG338300 Rh6DG325800
rosa_wichuraiana	Rw6G028220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1564
Acc16I	TGCGCA	1 cut(s)	2644
Acc36I	ACCTGC	4 cut(s)	2564, 3136, 4243, 5115
AccB1I	GGYRCC	1 cut(s)	4001
AccB7I	CCANNNNNTGG	2 cut(s)	209, 2015
AccBSI	CCGCTC	1 cut(s)	5182
AccI	GTMKAC	3 cut(s)	2466, 4644, 4995
AccII	CGCG	1 cut(s)	370
AclI	AACGTT	1 cut(s)	4155
AclWI	GGATC	6 cut(s)	1610, 2366, 2872, 3676, 4270, 4824
AcoI	YGGCCR	2 cut(s)	4954, 4965
AcuI	CTGAAG	6 cut(s)	131, 3381, 3858, 3960, 4080, 4371
AcyI	GRCGYC	1 cut(s)	3049
AdeI	CACNNNGTG	1 cut(s)	3407
AfaI	GTAC	9 cut(s)	1181, 1231, 1523, 1882, 2031, 2084, 4108, 4519, 5238
AfiI	CCNNNNNNNGG	7 cut(s)	103, 209, 2015, 3026, 3299, 4589, 4963
AflIII	ACRYGT	2 cut(s)	2351, 4751
AgeI	ACCGGT	1 cut(s)	1060
AhdI	GACNNNNNGTC	2 cut(s)	2242, 5262
AjnI	CCWGG	5 cut(s)	1251, 2036, 3232, 4434, 4636
AjuI	GAANNNNNNNTTGG	4 cut(s)	269, 301, 4853, 4885
AleI	CACNNNNGTG	1 cut(s)	2862
Alw21I	GWGCWC	2 cut(s)	4676, 4893
AlwI	GGATC	6 cut(s)	1610, 2366, 2872, 3676, 4270, 4824
AlwNI	CAGNNNCTG	3 cut(s)	2240, 3677, 3971
Ama87I	CYCGRG	3 cut(s)	3320, 4741, 5177
AoxI	GGCC	5 cut(s)	1290, 4954, 4965, 4986, 5227
AsiGI	ACCGGT	1 cut(s)	1060
AspLEI	GCGC	2 cut(s)	2645, 4664
AspS9I	GGNCC	5 cut(s)	125, 1909, 3809, 4222, 5227
AsuC2I	CCSGG	1 cut(s)	3878
AvaI	CYCGRG	3 cut(s)	3320, 4741, 5177
AvaII	GGWCC	4 cut(s)	125, 1909, 3809, 4222
BaeGI	GKGCMC	1 cut(s)	4004
BalI	TGGCCA	1 cut(s)	4967
BanI	GGYRCC	1 cut(s)	4001
BarI	GAAGNNNNNNTAC	2 cut(s)	5096, 5128
BbsI	GAAGAC	4 cut(s)	1937, 2238, 2340, 5204
Bbv12I	GWGCWC	2 cut(s)	4676, 4893
BbvCI	CCTCAGC	2 cut(s)	3651, 3678
BceAI	ACGGC	2 cut(s)	3004, 4944
BciT130I	CCWGG	5 cut(s)	1253, 2038, 3234, 4436, 4638
BclI	TGATCA	1 cut(s)	136
BcnI	CCSGG	1 cut(s)	3878
BfaI	CTAG	4 cut(s)	2951, 3008, 4389, 4841
BfmI	CTRYAG	4 cut(s)	1479, 4077, 4250, 4341
BfoI	RGCGCY	1 cut(s)	4665
BfuAI	ACCTGC	4 cut(s)	2564, 3136, 4243, 5115
BglI	GCCNNNNNGGC	1 cut(s)	2807
BglII	AGATCT	2 cut(s)	17, 1121
BmcAI	AGTACT	1 cut(s)	2031
Bme1390I	CCNGG	6 cut(s)	1253, 2038, 3234, 3878, 4436, 4638
Bme18I	GGWCC	4 cut(s)	125, 1909, 3809, 4222
BmeRI	GACNNNNNGTC	2 cut(s)	2242, 5262
BmeT110I	CYCGRG	3 cut(s)	3320, 4741, 5177
BmgT120I	GGNCC	5 cut(s)	125, 1909, 3809, 4222, 5227
BmiI	GGNNCC	6 cut(s)	2056, 3031, 4003, 4223, 5201, 5228
BmrFI	CCNGG	6 cut(s)	1253, 2038, 3234, 3878, 4436, 4638
BmrI	ACTGGG	4 cut(s)	162, 279, 1835, 5233
BmuI	ACTGGG	4 cut(s)	162, 279, 1835, 5233
BoxI	GACNNNNGTC	1 cut(s)	2397
BpiI	GAAGAC	4 cut(s)	1937, 2238, 2340, 5204
BplI	GAGNNNNNCTC	2 cut(s)	5160, 5192
BpmI	CTGGAG	3 cut(s)	2696, 3506, 4545
Bpu10I	CCTNAGC	2 cut(s)	3651, 3678
BpuEI	CTTGAG	4 cut(s)	1284, 1880, 4313, 4810
BpuMI	CCSGG	1 cut(s)	3878
Bsa29I	ATCGAT	1 cut(s)	2584
BsaAI	YACGTR	2 cut(s)	1430, 5240
BsaBI	GATNNNNATC	1 cut(s)	4053
BsaHI	GRCGYC	1 cut(s)	3049
BsaI	GGTCTC	9 cut(s)	451, 526, 601, 676, 751, 826, 901, 976, 1051
BsaWI	WCCGGW	2 cut(s)	127, 1060
Bsc4I	CCNNNNNNNGG	7 cut(s)	103, 209, 2015, 3026, 3299, 4589, 4963
Bse118I	RCCGGY	2 cut(s)	1060, 3066
Bse3DI	GCAATG	3 cut(s)	2264, 2803, 4534
Bse8I	GATNNNNATC	1 cut(s)	4053
BseBI	CCWGG	5 cut(s)	1253, 2038, 3234, 4436, 4638
BseCI	ATCGAT	1 cut(s)	2584
BseJI	GATNNNNATC	1 cut(s)	4053
BseLI	CCNNNNNNNGG	7 cut(s)	103, 209, 2015, 3026, 3299, 4589, 4963
BseMI	GCAATG	3 cut(s)	2264, 2803, 4534
BseRI	GAGGAG	2 cut(s)	295, 2388
BseSI	GKGCMC	1 cut(s)	4004
BsgI	GTGCAG	1 cut(s)	3384
Bsh1236I	CGCG	1 cut(s)	370
Bsh1285I	CGRYCG	1 cut(s)	368
BshFI	GGCC	5 cut(s)	1292, 4956, 4967, 4988, 5229
BshNI	GGYRCC	1 cut(s)	4001
BshTI	ACCGGT	1 cut(s)	1060
BshVI	ATCGAT	1 cut(s)	2584
BsiEI	CGRYCG	1 cut(s)	368
BsiHKAI	GWGCWC	2 cut(s)	4676, 4893
BsiHKCI	CYCGRG	3 cut(s)	3320, 4741, 5177
BsiSI	CCGG	5 cut(s)	128, 1061, 3067, 3629, 3877
BslFI	GGGAC	5 cut(s)	2531, 3163, 3381, 4235, 4619
BslI	CCNNNNNNNGG	7 cut(s)	103, 209, 2015, 3026, 3299, 4589, 4963
BsmFI	GGGAC	5 cut(s)	2531, 3163, 3381, 4235, 4619
BsmI	GAATGC	3 cut(s)	1984, 2798, 3569
BsnI	GGCC	5 cut(s)	1292, 4956, 4967, 4988, 5229
Bso31I	GGTCTC	9 cut(s)	451, 526, 601, 676, 751, 826, 901, 976, 1051
BsoBI	CYCGRG	3 cut(s)	3320, 4741, 5177
Bsp1286I	GDGCHC	3 cut(s)	4004, 4676, 4893
Bsp19I	CCATGG	2 cut(s)	2995, 4657
BspANI	GGCC	5 cut(s)	1292, 4956, 4967, 4988, 5229
BspDI	ATCGAT	1 cut(s)	2584
BspFNI	CGCG	1 cut(s)	370
BspHI	TCATGA	8 cut(s)	3475, 3826, 3868, 3928, 4144, 4210, 4453, 5046
BspLI	GGNNCC	6 cut(s)	2056, 3031, 4003, 4223, 5201, 5228
BspMAI	CTGCAG	2 cut(s)	1483, 4254
BspMI	ACCTGC	4 cut(s)	2564, 3136, 4243, 5115
BspPI	GGATC	6 cut(s)	1610, 2366, 2872, 3676, 4270, 4824
BspT107I	GGYRCC	1 cut(s)	4001
BspTNI	GGTCTC	9 cut(s)	451, 526, 601, 676, 751, 826, 901, 976, 1051
BsrBI	CCGCTC	1 cut(s)	5182
BsrDI	GCAATG	3 cut(s)	2264, 2803, 4534
BsrFI	RCCGGY	2 cut(s)	1060, 3066
BssAI	RCCGGY	2 cut(s)	1060, 3066
BssNAI	GTATAC	1 cut(s)	2467
BssNI	GRCGYC	1 cut(s)	3049
Bst1107I	GTATAC	1 cut(s)	2467
Bst2UI	CCWGG	5 cut(s)	1253, 2038, 3234, 4436, 4638
BstACI	GRCGYC	1 cut(s)	3049
BstAPI	GCANNNNNTGC	3 cut(s)	2263, 2606, 4882
BstBAI	YACGTR	2 cut(s)	1430, 5240
BstC8I	GCNNGC	6 cut(s)	1483, 1676, 1888, 2264, 3068, 3432
BstDSI	CCRYGG	3 cut(s)	2995, 4657, 5206
BstEII	GGTNACC	1 cut(s)	3610
BstENI	CCTNNNNNAGG	1 cut(s)	3297
BstFNI	CGCG	1 cut(s)	370
BstH2I	RGCGCY	1 cut(s)	4665
BstHHI	GCGC	2 cut(s)	2645, 4664
BstMCI	CGRYCG	1 cut(s)	368
BstMWI	GCNNNNNNNGC	8 cut(s)	1586, 1921, 1945, 2263, 2606, 2807, 3584, 4882
BstNI	CCWGG	5 cut(s)	1253, 2038, 3234, 4436, 4638
BstNSI	RCATGY	5 cut(s)	1678, 1890, 2355, 4027, 4755
BstPAI	GACNNNNGTC	1 cut(s)	2397
BstPI	GGTNACC	1 cut(s)	3610
BstSCI	CCNGG	6 cut(s)	1251, 2036, 3232, 3876, 4434, 4636
BstSFI	CTRYAG	4 cut(s)	1479, 4077, 4250, 4341
BstSLI	GKGCMC	1 cut(s)	4004
BstUI	CGCG	1 cut(s)	370
BstV2I	GAAGAC	4 cut(s)	1937, 2238, 2340, 5204
BstX2I	RGATCY	5 cut(s)	17, 1121, 2358, 4262, 4829
BstXI	CCANNNNNNTGG	2 cut(s)	2864, 5152
BstYI	RGATCY	5 cut(s)	17, 1121, 2358, 4262, 4829
BstZ17I	GTATAC	1 cut(s)	2467
Bsu15I	ATCGAT	1 cut(s)	2584
BsuRI	GGCC	5 cut(s)	1292, 4956, 4967, 4988, 5229
BsuTUI	ATCGAT	1 cut(s)	2584
BtgI	CCRYGG	3 cut(s)	2995, 4657, 5206
BtgZI	GCGATG	1 cut(s)	1963
BtsI	GCAGTG	2 cut(s)	1539, 2940
BveI	ACCTGC	4 cut(s)	2564, 3136, 4243, 5115
Cac8I	GCNNGC	6 cut(s)	1483, 1676, 1888, 2264, 3068, 3432
CaiI	CAGNNNCTG	3 cut(s)	2240, 3677, 3971
CciI	TCATGA	8 cut(s)	3475, 3826, 3868, 3928, 4144, 4210, 4453, 5046
CfoI	GCGC	2 cut(s)	2645, 4664
Cfr10I	RCCGGY	2 cut(s)	1060, 3066
Cfr13I	GGNCC	5 cut(s)	125, 1909, 3809, 4222, 5227
ClaI	ATCGAT	1 cut(s)	2584
CseI	GACGC	3 cut(s)	1904, 2529, 3038
Csp6I	GTAC	9 cut(s)	1180, 1230, 1522, 1881, 2030, 2083, 4107, 4518, 5237
CspAI	ACCGGT	1 cut(s)	1060
CspCI	CAANNNNNGTGG	2 cut(s)	2467, 2502
CviQI	GTAC	9 cut(s)	1180, 1230, 1522, 1881, 2030, 2083, 4107, 4518, 5237
DraI	TTTAAA	2 cut(s)	1594, 3697
DraIII	CACNNNGTG	1 cut(s)	3407
DrdI	GACNNNNNNGTC	1 cut(s)	1564
DriI	GACNNNNNGTC	2 cut(s)	2242, 5262
DseDI	GACNNNNNNGTC	1 cut(s)	1564
EaeI	YGGCCR	2 cut(s)	4954, 4965
Eam1105I	GACNNNNNGTC	2 cut(s)	2242, 5262
EciI	GGCGGA	1 cut(s)	4771
Eco147I	AGGCCT	1 cut(s)	1292
Eco31I	GGTCTC	9 cut(s)	451, 526, 601, 676, 751, 826, 901, 976, 1051
Eco32I	GATATC	2 cut(s)	3244, 4206
Eco47I	GGWCC	4 cut(s)	125, 1909, 3809, 4222
Eco57I	CTGAAG	6 cut(s)	131, 3381, 3858, 3960, 4080, 4371
Eco88I	CYCGRG	3 cut(s)	3320, 4741, 5177
Eco91I	GGTNACC	1 cut(s)	3610
EcoNI	CCTNNNNNAGG	1 cut(s)	3297
EcoO109I	RGGNCCY	1 cut(s)	5227
EcoO65I	GGTNACC	1 cut(s)	3610
EcoRI	GAATTC	4 cut(s)	2139, 4392, 4615, 4868
EcoRII	CCWGG	5 cut(s)	1251, 2036, 3232, 4434, 4636
EcoRV	GATATC	2 cut(s)	3244, 4206
EcoT22I	ATGCAT	1 cut(s)	1873
FalI	AAGNNNNNCTT	2 cut(s)	1143, 1175
FaqI	GGGAC	5 cut(s)	2531, 3163, 3381, 4235, 4619
FauI	CCCGC	1 cut(s)	3041
FauNDI	CATATG	2 cut(s)	2011, 4668
FbaI	TGATCA	1 cut(s)	136
FblI	GTMKAC	3 cut(s)	2466, 4644, 4995
FspBI	CTAG	4 cut(s)	2951, 3008, 4389, 4841
FspI	TGCGCA	1 cut(s)	2644
GlaI	GCGC	2 cut(s)	2644, 4663
GsuI	CTGGAG	3 cut(s)	2696, 3506, 4545
HaeII	RGCGCY	1 cut(s)	4665
HaeIII	GGCC	5 cut(s)	1292, 4956, 4967, 4988, 5229
HapII	CCGG	5 cut(s)	128, 1061, 3067, 3629, 3877
HgaI	GACGC	3 cut(s)	1904, 2529, 3038
HhaI	GCGC	2 cut(s)	2645, 4664
Hin1I	GRCGYC	1 cut(s)	3049
Hin6I	GCGC	2 cut(s)	2643, 4662
HinP1I	GCGC	2 cut(s)	2643, 4662
HincII	GTYRAC	6 cut(s)	175, 2047, 2854, 3273, 4449, 4996
HindII	GTYRAC	6 cut(s)	175, 2047, 2854, 3273, 4449, 4996
HpaI	GTTAAC	1 cut(s)	3273
HpaII	CCGG	5 cut(s)	128, 1061, 3067, 3629, 3877
Hpy99I	CGWCG	2 cut(s)	2304, 4907
HpyCH4IV	ACGT	8 cut(s)	1429, 2299, 3152, 3370, 3955, 4155, 4902, 5239
HpyF10VI	GCNNNNNNNGC	8 cut(s)	1586, 1921, 1945, 2263, 2606, 2807, 3584, 4882
HpySE526I	ACGT	8 cut(s)	1429, 2299, 3152, 3370, 3955, 4155, 4902, 5239
Hsp92I	GRCGYC	1 cut(s)	3049
HspAI	GCGC	2 cut(s)	2643, 4662
KroI	GCCGGC	1 cut(s)	3066
KroNI	GCCGGC	1 cut(s)	3068
Ksp22I	TGATCA	1 cut(s)	136
KspAI	GTTAAC	1 cut(s)	3273
LmnI	GCTCC	2 cut(s)	3631, 4810
MaeI	CTAG	4 cut(s)	2951, 3008, 4389, 4841
MaeII	ACGT	8 cut(s)	1429, 2299, 3152, 3370, 3955, 4155, 4902, 5239
MbiI	CCGCTC	1 cut(s)	5182
MfeI	CAATTG	2 cut(s)	204, 5052
MflI	RGATCY	5 cut(s)	17, 1121, 2358, 4262, 4829
MhlI	GDGCHC	3 cut(s)	4004, 4676, 4893
MlsI	TGGCCA	1 cut(s)	4967
MluNI	TGGCCA	1 cut(s)	4967
MmeI	TCCRAC	2 cut(s)	3471, 4407
Mox20I	TGGCCA	1 cut(s)	4967
Mph1103I	ATGCAT	1 cut(s)	1873
MroNI	GCCGGC	1 cut(s)	3066
MscI	TGGCCA	1 cut(s)	4967
MslI	CAYNNNNRTG	5 cut(s)	1840, 2565, 2862, 3768, 4278
Msp20I	TGGCCA	1 cut(s)	4967
MspA1I	CMGCKG	1 cut(s)	4565
MspI	CCGG	5 cut(s)	128, 1061, 3067, 3629, 3877
MspR9I	CCNGG	6 cut(s)	1253, 2038, 3234, 3878, 4436, 4638
MunI	CAATTG	2 cut(s)	204, 5052
Mva1269I	GAATGC	3 cut(s)	1984, 2798, 3569
MvaI	CCWGG	5 cut(s)	1253, 2038, 3234, 4436, 4638
MvnI	CGCG	1 cut(s)	370
MwoI	GCNNNNNNNGC	8 cut(s)	1586, 1921, 1945, 2263, 2606, 2807, 3584, 4882
NaeI	GCCGGC	1 cut(s)	3068
NciI	CCSGG	1 cut(s)	3878
NcoI	CCATGG	2 cut(s)	2995, 4657
NdeI	CATATG	2 cut(s)	2011, 4668
NgoMIV	GCCGGC	1 cut(s)	3066
NlaIV	GGNNCC	6 cut(s)	2056, 3031, 4003, 4223, 5201, 5228
NsbI	TGCGCA	1 cut(s)	2644
NsiI	ATGCAT	1 cut(s)	1873
NspI	RCATGY	5 cut(s)	1678, 1890, 2355, 4027, 4755
OliI	CACNNNNGTG	1 cut(s)	2862
PaeI	GCATGC	2 cut(s)	1678, 1890
PaeR7I	CTCGAG	3 cut(s)	3320, 4741, 5177
PagI	TCATGA	8 cut(s)	3475, 3826, 3868, 3928, 4144, 4210, 4453, 5046
PceI	AGGCCT	1 cut(s)	1292
PciI	ACATGT	2 cut(s)	2351, 4751
PcsI	WCGNNNNNNNCGW	2 cut(s)	3376, 4860
PctI	GAATGC	3 cut(s)	1984, 2798, 3569
PdiI	GCCGGC	1 cut(s)	3068
PflMI	CCANNNNNTGG	2 cut(s)	209, 2015
PinAI	ACCGGT	1 cut(s)	1060
Ppu21I	YACGTR	2 cut(s)	1430, 5240
PscI	ACATGT	2 cut(s)	2351, 4751
PshAI	GACNNNNGTC	1 cut(s)	2397
Psp1406I	AACGTT	1 cut(s)	4155
Psp6I	CCWGG	5 cut(s)	1251, 2036, 3232, 4434, 4636
PspEI	GGTNACC	1 cut(s)	3610
PspGI	CCWGG	5 cut(s)	1251, 2036, 3232, 4434, 4636
PspN4I	GGNNCC	6 cut(s)	2056, 3031, 4003, 4223, 5201, 5228
PspPI	GGNCC	5 cut(s)	125, 1909, 3809, 4222, 5227
PspXI	VCTCGAGB	1 cut(s)	4741
PstI	CTGCAG	2 cut(s)	1483, 4254
PstNI	CAGNNNCTG	3 cut(s)	2240, 3677, 3971
PsuI	RGATCY	5 cut(s)	17, 1121, 2358, 4262, 4829
PvuII	CAGCTG	1 cut(s)	4565
RsaI	GTAC	9 cut(s)	1181, 1231, 1523, 1882, 2031, 2084, 4108, 4519, 5238
RsaNI	GTAC	9 cut(s)	1180, 1230, 1522, 1881, 2030, 2083, 4107, 4518, 5237
RseI	CAYNNNNRTG	5 cut(s)	1840, 2565, 2862, 3768, 4278
SalI	GTCGAC	1 cut(s)	4994
Sau96I	GGNCC	5 cut(s)	125, 1909, 3809, 4222, 5227
ScaI	AGTACT	1 cut(s)	2031
ScrFI	CCNGG	6 cut(s)	1253, 2038, 3234, 3878, 4436, 4638
SduI	GDGCHC	3 cut(s)	4004, 4676, 4893
SfcI	CTRYAG	4 cut(s)	1479, 4077, 4250, 4341
Sfr274I	CTCGAG	3 cut(s)	3320, 4741, 5177
SinI	GGWCC	4 cut(s)	125, 1909, 3809, 4222
SlaI	CTCGAG	3 cut(s)	3320, 4741, 5177
SmiMI	CAYNNNNRTG	5 cut(s)	1840, 2565, 2862, 3768, 4278
SmlI	CTYRAG	7 cut(s)	1299, 1859, 3320, 4292, 4741, 4825, 5177
SmoI	CTYRAG	7 cut(s)	1299, 1859, 3320, 4292, 4741, 4825, 5177
SphI	GCATGC	2 cut(s)	1678, 1890
SseBI	AGGCCT	1 cut(s)	1292
SspI	AATATT	1 cut(s)	4171
SspMI	CTAG	4 cut(s)	2951, 3008, 4389, 4841
StuI	AGGCCT	1 cut(s)	1292
StyD4I	CCNGG	6 cut(s)	1251, 2036, 3232, 3876, 4434, 4636
TaiI	ACGT	8 cut(s)	1432, 2302, 3155, 3373, 3958, 4158, 4905, 5242
TaqI	TCGA	8 cut(s)	1415, 2584, 3321, 3379, 4742, 4905, 4995, 5178
TatI	WGTACW	6 cut(s)	1179, 1229, 1521, 1880, 2029, 2082
TauI	GCSGC	4 cut(s)	1927, 2981, 3066, 4959
TspGWI	ACGGA	1 cut(s)	3161
Van91I	CCANNNNNTGG	2 cut(s)	209, 2015
VpaK11BI	GGWCC	4 cut(s)	125, 1909, 3809, 4222
XagI	CCTNNNNNAGG	1 cut(s)	3297
XbaI	TCTAGA	2 cut(s)	2950, 4388
XceI	RCATGY	5 cut(s)	1678, 1890, 2355, 4027, 4755
XcmI	CCANNNNNNNNNTGG	2 cut(s)	2451, 3343
XhoI	CTCGAG	3 cut(s)	3320, 4741, 5177
XmiI	GTMKAC	3 cut(s)	2466, 4644, 4995
XspI	CTAG	4 cut(s)	2951, 3008, 4389, 4841
ZrmI	AGTACT	1 cut(s)	2031
Zsp2I	ATGCAT	1 cut(s)	1873

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.