Rmu_sc0000109.1_g000001

Abscisic acid receptor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000109.1
Physical Location & Seq
Reverse (-)
144 .. 470
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000109.1_g000001.1.cds

Sequence Viewer

Length: 327 bp
atggagagctaccatagccatgccctcttaccaaaccagtgtggctcaagcttggtccagaacatagatgcaccacttcctctggtttggtcaatccttcgccagtttgataaccctcaagcctacaagcagttcgtaaggagctgcacaatgcccgctggggatggaggcataggaagcatatgtgaagtgatggtcagcactggcttacctgccaaaaccagcatggagaggctcgacaagcttgacaatgacaagcatgtccttgatttcagcattgttggcgaagaacacaagctggtgacactactagaattttgctcttag

Protein Analysis

108

Amino Acids

11.92

Weight (kDa)

5.15

Isoelectric Point (pI)

48.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 260
Acc36I ACCTGC 1 cut(s) 220
AciI CCGC 1 cut(s) 156
AcsI RAATTY 1 cut(s) 314
AluBI AGCT 5 cut(s) 9, 51, 144, 244, 298
AluI AGCT 5 cut(s) 9, 51, 144, 244, 298
ApeKI GCWGC 1 cut(s) 144
ApoI RAATTY 1 cut(s) 314
AspS9I GGNCC 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 313
AvaII GGWCC 1 cut(s) 55
BbvI GCAGC 1 cut(s) 131
BccI CCATC 2 cut(s) 158, 187
BfaI CTAG 1 cut(s) 311
BfuAI ACCTGC 1 cut(s) 220
BisI GCNGC 1 cut(s) 145
BlsI GCNGC 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 55
BmsI GCATC 1 cut(s) 58
BpuEI CTTGAG 2 cut(s) 31, 102
Bse1I ACTGG 3 cut(s) 37, 103, 208
BseGI GGATG 1 cut(s) 169
BseNI ACTGG 3 cut(s) 37, 103, 208
BseXI GCAGC 1 cut(s) 131
BseYI CCCAGC 1 cut(s) 158
BsgI GTGCAG 1 cut(s) 130
BspACI CCGC 1 cut(s) 156
BspMI ACCTGC 1 cut(s) 220
BsrI ACTGG 3 cut(s) 37, 103, 208
BstC8I GCNNGC 1 cut(s) 156
BstDEI CTNAG 1 cut(s) 324
BstF5I GGATG 1 cut(s) 169
BstMWI GCNNNNNNNGC 4 cut(s) 15, 177, 241, 282
BstNSI RCATGY 1 cut(s) 263
BstV1I GCAGC 1 cut(s) 131
BtsCI GGATG 1 cut(s) 169
BtsIMutI CAGTG 2 cut(s) 44, 201
BveI ACCTGC 1 cut(s) 220
Cac8I GCNNGC 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 55
CviAII CATG 3 cut(s) 20, 226, 260
DdeI CTNAG 1 cut(s) 324
DrdI GACNNNNNNGTC 1 cut(s) 260
DseDI GACNNNNNNGTC 1 cut(s) 260
Eco47I GGWCC 1 cut(s) 55
FaeI CATG 3 cut(s) 23, 229, 263
FaiI YATR 8 cut(s) 15, 21, 65, 173, 182, 184, 227, 261
FatI CATG 3 cut(s) 19, 225, 259
FauI CCCGC 1 cut(s) 163
FauNDI CATATG 1 cut(s) 182
Fnu4HI GCNGC 1 cut(s) 145
FokI GGATG 1 cut(s) 176
Fsp4HI GCNGC 1 cut(s) 145
FspBI CTAG 1 cut(s) 311
GluI GCNGC 1 cut(s) 145
GsaI CCCAGC 1 cut(s) 162
Hin1II CATG 3 cut(s) 23, 229, 263
HindIII AAGCTT 2 cut(s) 49, 242
HphI GGTGA 1 cut(s) 313
Hpy188III TCNNGA 1 cut(s) 58
HpyAV CCTTC 1 cut(s) 107
HpyCH4V TGCA 2 cut(s) 71, 147
HpyF10VI GCNNNNNNNGC 4 cut(s) 15, 177, 241, 282
HpyF3I CTNAG 1 cut(s) 324
Hsp92II CATG 3 cut(s) 23, 229, 263
LmnI GCTCC 1 cut(s) 141
LpnPI CCDG 9 cut(s) 50, 68, 71, 116, 144, 189, 225, 235, 284
Lsp1109I GCAGC 1 cut(s) 131
LweI GCATC 1 cut(s) 58
MaeI CTAG 1 cut(s) 311
MaeIII GTNAC 1 cut(s) 301
MboII GAAGA 1 cut(s) 299
MluCI AATT 1 cut(s) 314
MnlI CCTC 5 cut(s) 35, 90, 126, 161, 225
MslI CAYNNNNRTG 1 cut(s) 18
MspA1I CMGCKG 1 cut(s) 158
MwoI GCNNNNNNNGC 4 cut(s) 15, 177, 241, 282
NdeI CATATG 1 cut(s) 182
NlaIII CATG 3 cut(s) 23, 229, 263
NmuCI GTSAC 1 cut(s) 301
NspI RCATGY 1 cut(s) 263
PkrI GCNGC 1 cut(s) 146
PspFI CCCAGC 1 cut(s) 158
PspPI GGNCC 1 cut(s) 55
RseI CAYNNNNRTG 1 cut(s) 18
SatI GCNGC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 55
SetI ASST 6 cut(s) 11, 53, 146, 214, 246, 300
SfaNI GCATC 1 cut(s) 58
SinI GGWCC 1 cut(s) 55
SmiMI CAYNNNNRTG 1 cut(s) 18
SmlI CTYRAG 2 cut(s) 46, 117
SmoI CTYRAG 2 cut(s) 46, 117
Sse9I AATT 1 cut(s) 314
SsiI CCGC 1 cut(s) 156
SspMI CTAG 1 cut(s) 311
TaqI TCGA 1 cut(s) 237
TasI AATT 1 cut(s) 314
TscAI CASTG 2 cut(s) 44, 208
TseFI GTSAC 1 cut(s) 301
TseI GCWGC 1 cut(s) 144
Tsp45I GTSAC 1 cut(s) 301
TspRI CASTG 2 cut(s) 44, 208
VpaK11BI GGWCC 1 cut(s) 55
XapI RAATTY 1 cut(s) 314
XceI RCATGY 1 cut(s) 263
XcmI CCANNNNNNNNNTGG 1 cut(s) 223
XspI CTAG 1 cut(s) 311
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.