Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000379.1

Orthogroup ID

OG0006684

Physical Location & Seq

Genomic Coordinates Reverse (-)

87867 .. 90944

Gene Structure 3078 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000379.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 693 bp

atgtcgccctcgtgtggtgggattgagcattcgttgggacgagagggaataagaggaagtgagtctttgactgaagtcggaggtgtcattgctcaaactgtttctgaggcggaaaatgacacagatcttagtgttgccagtgacgggtgtttagaagctgaggaagagtcccagatgtcctcctcagttgagattttgtccgaagaagttatcactccagggagaggttctgatctggatgtcacacaaagtaatatctggaaagtgaatgctgaggaatcttcatatataggctctgatatggaggaacttaagcaaactcaatctgcctctattgctccaggatgtgagatgttacaaggaggatttgatgttatttctcattcacatgacaaatctgaggatggtaaaagggaggaagctcaggctgatcgacatgattatgtctctaaagaaaagcatctacatataggggaaactaatagagcctctccaagttctggtaatactgttgttactaaatcagatcttgatgtttcaaagtctatagtggagcaacatgaagagattcctcaggcagacaaactatccaagctggctgatgatgcagaacctccaaaaagatcaacaactctatggggtgctatgaaatcgtttgcggatggaattatcagtattttcagacaacagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

230

Amino Acids

24.75

Weight (kDa)

4.5

Isoelectric Point (pI)

60.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006684)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G58210 AT5G58210 AT5G58210 AT5G58210
fragaria_vesca	FvH4_5g27110 FvH4_5g27110 FvH4_5g27110 FvH4_5g27110 FvH4_5g27110
malus_domestica	MD10G1047400.v1.1
prunus_persica	Prupe.8G056400_v2.0.a1
pyrus_communis	pycom10g03350
rosa_chinensis	RchiOBHm_Chr7g0218101
rosa_laevigata	RLG00000002405
rosa_multiflora	Rmu_sc0000379.1_g000020
rosa_roxburghii	Rroxscaffold_3G00241320
rosa_rugosa	Rorug07G0174000 Rorug07G0174000 Rorug07G0174000
rosa_samantha	Rh2DG626300 Rh4BG100100 Rh7AG316400 Rh7BG307500 Rh7CG333400 Rh7DG315300
rosa_wichuraiana	Rw7G026790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	500
AciI	CCGC	2 cut(s)	110, 659
AcuI	CTGAAG	1 cut(s)	93
AfiI	CCNNNNNNNGG	4 cut(s)	14, 144, 224, 500
AflII	CTTAAG	1 cut(s)	311
AgsI	TTSAA	1 cut(s)	540
AjnI	CCWGG	2 cut(s)	217, 340
AluBI	AGCT	3 cut(s)	158, 422, 595
AluI	AGCT	3 cut(s)	158, 422, 595
Alw26I	GTCTC	1 cut(s)	451
Asp700I	GAANNNNTTC	1 cut(s)	567
AxyI	CCTNAGG	1 cut(s)	573
BauI	CACGAG	1 cut(s)	10
BbvCI	CCTCAGC	2 cut(s)	159, 273
BccI	CCATC	2 cut(s)	398, 656
BciT130I	CCWGG	2 cut(s)	219, 342
BcoDI	GTCTC	1 cut(s)	451
BfmI	CTRYAG	1 cut(s)	546
BfrI	CTTAAG	1 cut(s)	311
BglII	AGATCT	2 cut(s)	124, 526
Bme1390I	CCNGG	2 cut(s)	219, 342
BmrFI	CCNGG	2 cut(s)	219, 342
BmsI	GCATC	2 cut(s)	469, 595
BoxI	GACNNNNGTC	1 cut(s)	74
BpmI	CTGGAG	2 cut(s)	201, 324
Bpu10I	CCTNAGC	3 cut(s)	159, 273, 423
BsaJI	CCNNGG	1 cut(s)	218
Bsc4I	CCNNNNNNNGG	4 cut(s)	14, 144, 224, 500
Bse1I	ACTGG	1 cut(s)	138
Bse21I	CCTNAGG	1 cut(s)	573
Bse3DI	GCAATG	1 cut(s)	87
BseBI	CCWGG	2 cut(s)	219, 342
BseDI	CCNNGG	1 cut(s)	218
BseGI	GGATG	4 cut(s)	244, 350, 409, 667
BseLI	CCNNNNNNNGG	4 cut(s)	14, 144, 224, 500
BseMI	GCAATG	1 cut(s)	87
BseMII	CTCAG	7 cut(s)	96, 150, 198, 264, 390, 437, 587
BseNI	ACTGG	1 cut(s)	138
BseRI	GAGGAG	1 cut(s)	172
BslFI	GGGAC	2 cut(s)	51, 154
BslI	CCNNNNNNNGG	4 cut(s)	14, 144, 224, 500
BsmAI	GTCTC	1 cut(s)	451
BsmFI	GGGAC	2 cut(s)	51, 154
BsmI	GAATGC	2 cut(s)	28, 274
Bsp143I	GATC	5 cut(s)	124, 232, 430, 526, 623
BspACI	CCGC	2 cut(s)	110, 659
BspCNI	CTCAG	7 cut(s)	97, 151, 197, 265, 391, 436, 586
BspTI	CTTAAG	1 cut(s)	311
BsrDI	GCAATG	1 cut(s)	87
BsrI	ACTGG	1 cut(s)	138
BssECI	CCNNGG	1 cut(s)	218
BssMI	GATC	5 cut(s)	124, 232, 430, 526, 623
BssSI	CACGAG	1 cut(s)	10
Bst2BI	CACGAG	1 cut(s)	10
Bst2UI	CCWGG	2 cut(s)	219, 342
Bst4CI	ACNGT	3 cut(s)	100, 511, 690
Bst6I	CTCTTC	2 cut(s)	159, 558
BstAFI	CTTAAG	1 cut(s)	311
BstC8I	GCNNGC	1 cut(s)	597
BstDEI	CTNAG	8 cut(s)	105, 128, 159, 184, 273, 399, 423, 573
BstF5I	GGATG	4 cut(s)	244, 350, 409, 667
BstKTI	GATC	5 cut(s)	127, 235, 433, 529, 626
BstMAI	GTCTC	1 cut(s)	451
BstMBI	GATC	5 cut(s)	124, 232, 430, 526, 623
BstMWI	GCNNNNNNNGC	2 cut(s)	335, 605
BstNI	CCWGG	2 cut(s)	219, 342
BstPAI	GACNNNNGTC	1 cut(s)	74
BstSCI	CCNGG	2 cut(s)	217, 340
BstSFI	CTRYAG	1 cut(s)	546
BstX2I	RGATCY	2 cut(s)	124, 526
BstYI	RGATCY	2 cut(s)	124, 526
Bsu36I	CCTNAGG	1 cut(s)	573
BtsCI	GGATG	4 cut(s)	244, 350, 409, 667
BtsIMutI	CAGTG	1 cut(s)	145
Cac8I	GCNNGC	1 cut(s)	597
CviAII	CATG	3 cut(s)	389, 437, 560
CviJI	RGCY	7 cut(s)	158, 294, 422, 428, 488, 595, 599
CviKI_1	RGCY	7 cut(s)	158, 294, 422, 428, 488, 595, 599
DdeI	CTNAG	8 cut(s)	105, 128, 159, 184, 273, 399, 423, 573
DpnI	GATC	5 cut(s)	126, 234, 432, 528, 625
DpnII	GATC	5 cut(s)	124, 232, 430, 526, 623
Eam1104I	CTCTTC	2 cut(s)	159, 558
EarI	CTCTTC	2 cut(s)	159, 558
EciI	GGCGGA	1 cut(s)	125
Eco57I	CTGAAG	1 cut(s)	93
Eco81I	CCTNAGG	1 cut(s)	573
EcoRII	CCWGG	2 cut(s)	217, 340
FaeI	CATG	3 cut(s)	392, 440, 563
FalI	AAGNNNNNCTT	2 cut(s)	49, 81
FaqI	GGGAC	2 cut(s)	51, 154
FatI	CATG	3 cut(s)	388, 436, 559
FokI	GGATG	4 cut(s)	251, 357, 416, 674
GsuI	CTGGAG	2 cut(s)	201, 324
Hin1II	CATG	3 cut(s)	392, 440, 563
HinfI	GANTC	4 cut(s)	62, 167, 278, 568
Hpy188I	TCNGA	8 cut(s)	80, 106, 202, 232, 298, 400, 526, 683
Hpy188III	TCNNGA	3 cut(s)	236, 259, 530
HpyCH4III	ACNGT	3 cut(s)	100, 511, 690
HpyCH4V	TGCA	1 cut(s)	608
HpyF10VI	GCNNNNNNNGC	2 cut(s)	335, 605
HpyF3I	CTNAG	8 cut(s)	105, 128, 159, 184, 273, 399, 423, 573
Hsp92II	CATG	3 cut(s)	392, 440, 563
Kzo9I	GATC	5 cut(s)	124, 232, 430, 526, 623
LmnI	GCTCC	2 cut(s)	343, 553
LweI	GCATC	2 cut(s)	469, 595
MaeIII	GTNAC	4 cut(s)	140, 241, 354, 514
MalI	GATC	5 cut(s)	126, 234, 432, 528, 625
MboI	GATC	5 cut(s)	124, 232, 430, 526, 623
MboII	GAAGA	4 cut(s)	176, 215, 273, 575
MflI	RGATCY	2 cut(s)	124, 526
MluCI	AATT	1 cut(s)	666
MlyI	GAGTC	2 cut(s)	71, 176
MmeI	TCCRAC	1 cut(s)	58
MroXI	GAANNNNTTC	1 cut(s)	567
MseI	TTAA	1 cut(s)	312
MslI	CAYNNNNRTG	2 cut(s)	387, 441
MspCI	CTTAAG	1 cut(s)	311
MspR9I	CCNGG	2 cut(s)	219, 342
Mva1269I	GAATGC	2 cut(s)	28, 274
MvaI	CCWGG	2 cut(s)	219, 342
MwoI	GCNNNNNNNGC	2 cut(s)	335, 605
NdeII	GATC	5 cut(s)	124, 232, 430, 526, 623
NlaIII	CATG	3 cut(s)	392, 440, 563
NmuCI	GTSAC	2 cut(s)	140, 241
PctI	GAATGC	2 cut(s)	28, 274
PdmI	GAANNNNTTC	1 cut(s)	567
PfeI	GAWTC	2 cut(s)	278, 568
PflMI	CCANNNNNTGG	1 cut(s)	500
PfoI	TCCNGGA	1 cut(s)	340
PleI	GAGTC	2 cut(s)	70, 175
PpsI	GAGTC	2 cut(s)	70, 175
PshAI	GACNNNNGTC	1 cut(s)	74
Psp6I	CCWGG	2 cut(s)	217, 340
PspGI	CCWGG	2 cut(s)	217, 340
PsuI	RGATCY	2 cut(s)	124, 526
RseI	CAYNNNNRTG	2 cut(s)	387, 441
SaqAI	TTAA	1 cut(s)	312
Sau3AI	GATC	5 cut(s)	124, 232, 430, 526, 623
SchI	GAGTC	2 cut(s)	71, 176
ScrFI	CCNGG	2 cut(s)	219, 342
SetI	ASST	6 cut(s)	85, 160, 229, 424, 597, 616
SfaNI	GCATC	2 cut(s)	469, 595
SfcI	CTRYAG	1 cut(s)	546
SmiMI	CAYNNNNRTG	2 cut(s)	387, 441
SmlI	CTYRAG	1 cut(s)	311
SmoI	CTYRAG	1 cut(s)	311
Sse9I	AATT	1 cut(s)	666
SsiI	CCGC	2 cut(s)	110, 659
StyD4I	CCNGG	2 cut(s)	217, 340
TaaI	ACNGT	3 cut(s)	100, 511, 690
TaqI	TCGA	1 cut(s)	433
TasI	AATT	1 cut(s)	666
TfiI	GAWTC	2 cut(s)	278, 568
Tru1I	TTAA	1 cut(s)	312
Tru9I	TTAA	1 cut(s)	312
TscAI	CASTG	1 cut(s)	145
TseFI	GTSAC	2 cut(s)	140, 241
Tsp45I	GTSAC	2 cut(s)	140, 241
TspDTI	ATGAA	3 cut(s)	273, 576, 662
TspRI	CASTG	1 cut(s)	145
Van91I	CCANNNNNTGG	1 cut(s)	500
Vha464I	CTTAAG	1 cut(s)	311
XmnI	GAANNNNTTC	1 cut(s)	567

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.