Rmu_sc0000470.1_g000006

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000470.1
Physical Location & Seq
Reverse (-)
32888 .. 33220
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000470.1_g000006.1.cds

Sequence Viewer

Length: 333 bp
atggcgtataggaggaggcagcaggtgtcggggtttcgattcgaagagggagaagaatcaagaaatcgaaattcaattattccgccgtcgccgtcgtcgtcggcggcggaggcgggggacgattcgcttgccgccaaagcgataagagcttcttcggctcatcgggactcgtctctctcctctgcttatgctgctcgaggcgttcattctggctctcctctctccccttcagctcctcagttttcgaaatcaatccccaccgccgcagcaactgctgctacttctcttccctctcccacccaggttcggtctttgtttcgttttggtgtgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

11.51

Weight (kDa)

10.76

Isoelectric Point (pI)

77.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010829)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 13
Acc36I ACCTGC 1 cut(s) 13
AciI CCGC 7 cut(s) 83, 104, 107, 113, 132, 261, 264
AcsI RAATTY 1 cut(s) 70
AcuI CTGAAG 1 cut(s) 213
AfiI CCNNNNNNNGG 1 cut(s) 306
AgsI TTSAA 1 cut(s) 75
AjnI CCWGG 1 cut(s) 300
AluBI AGCT 2 cut(s) 149, 233
AluI AGCT 2 cut(s) 149, 233
Alw26I GTCTC 1 cut(s) 177
AlwNI CAGNNNCTG 1 cut(s) 272
Ama87I CYCGRG 1 cut(s) 195
ApeKI GCWGC 4 cut(s) 19, 191, 266, 275
ApoI RAATTY 1 cut(s) 70
AsuII TTCGAA 2 cut(s) 42, 245
AvaI CYCGRG 1 cut(s) 195
BbvI GCAGC 4 cut(s) 31, 178, 262, 278
BceAI ACGGC 2 cut(s) 70, 76
BcgI CGANNNNNNTGC 2 cut(s) 110, 144
BciT130I CCWGG 1 cut(s) 302
BcoDI GTCTC 1 cut(s) 177
BfuAI ACCTGC 1 cut(s) 13
BisI GCNGC 7 cut(s) 20, 105, 132, 192, 264, 267, 276
BlsI GCNGC 7 cut(s) 21, 106, 133, 193, 265, 268, 277
Bme1390I CCNGG 1 cut(s) 302
BmeT110I CYCGRG 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 302
Bpu14I TTCGAA 2 cut(s) 42, 245
BsaJI CCNNGG 1 cut(s) 300
Bsc4I CCNNNNNNNGG 1 cut(s) 306
BseBI CCWGG 1 cut(s) 302
BseDI CCNNGG 1 cut(s) 300
BseLI CCNNNNNNNGG 1 cut(s) 306
BseMII CTCAG 1 cut(s) 251
BseRI GAGGAG 4 cut(s) 28, 169, 207, 225
BseXI GCAGC 4 cut(s) 31, 178, 262, 278
BsiHKCI CYCGRG 1 cut(s) 195
BslFI GGGAC 2 cut(s) 131, 179
BslI CCNNNNNNNGG 1 cut(s) 306
BsmAI GTCTC 1 cut(s) 177
BsmBI CGTCTC 1 cut(s) 177
BsmFI GGGAC 2 cut(s) 131, 179
BsoBI CYCGRG 1 cut(s) 195
Bsp119I TTCGAA 2 cut(s) 42, 245
BspACI CCGC 7 cut(s) 83, 104, 107, 113, 132, 261, 264
BspCNI CTCAG 1 cut(s) 250
BspMI ACCTGC 1 cut(s) 13
BspT104I TTCGAA 2 cut(s) 42, 245
BssECI CCNNGG 1 cut(s) 300
Bst2UI CCWGG 1 cut(s) 302
Bst6I CTCTTC 2 cut(s) 39, 291
BstAPI GCANNNNNTGC 2 cut(s) 272, 275
BstBI TTCGAA 2 cut(s) 42, 245
BstC8I GCNNGC 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 237
BstMAI GTCTC 1 cut(s) 177
BstMWI GCNNNNNNNGC 7 cut(s) 110, 137, 146, 155, 191, 272, 275
BstNI CCWGG 1 cut(s) 302
BstSCI CCNGG 1 cut(s) 300
BstV1I GCAGC 4 cut(s) 31, 178, 262, 278
BveI ACCTGC 1 cut(s) 13
Cac8I GCNNGC 1 cut(s) 129
CaiI CAGNNNCTG 1 cut(s) 272
CviJI RGCY 4 cut(s) 149, 158, 213, 233
CviKI_1 RGCY 4 cut(s) 149, 158, 213, 233
DdeI CTNAG 1 cut(s) 237
Eam1104I CTCTTC 2 cut(s) 39, 291
EarI CTCTTC 2 cut(s) 39, 291
EciI GGCGGA 2 cut(s) 72, 122
Eco57I CTGAAG 1 cut(s) 213
Eco88I CYCGRG 1 cut(s) 195
EcoRII CCWGG 1 cut(s) 300
Esp3I CGTCTC 1 cut(s) 177
FaiI YATR 2 cut(s) 9, 189
FalI AAGNNNNNCTT 2 cut(s) 136, 168
FaqI GGGAC 2 cut(s) 131, 179
FauI CCCGC 1 cut(s) 106
Fnu4HI GCNGC 7 cut(s) 20, 105, 132, 192, 264, 267, 276
Fsp4HI GCNGC 7 cut(s) 20, 105, 132, 192, 264, 267, 276
GluI GCNGC 7 cut(s) 20, 105, 132, 192, 264, 267, 276
HinfI GANTC 4 cut(s) 39, 56, 122, 167
Hpy188III TCNNGA 2 cut(s) 60, 164
Hpy99I CGWCG 4 cut(s) 91, 97, 100, 103
HpyAV CCTTC 1 cut(s) 237
HpyF10VI GCNNNNNNNGC 7 cut(s) 110, 137, 146, 155, 191, 272, 275
HpyF3I CTNAG 1 cut(s) 237
LmnI GCTCC 1 cut(s) 238
LpnPI CCDG 4 cut(s) 8, 195, 287, 314
Lsp1109I GCAGC 4 cut(s) 31, 178, 262, 278
MboII GAAGA 4 cut(s) 56, 65, 144, 278
MluCI AATT 2 cut(s) 70, 75
MlyI GAGTC 1 cut(s) 161
MnlI CCTC 9 cut(s) 6, 9, 40, 103, 190, 191, 228, 246, 301
MspR9I CCNGG 1 cut(s) 302
MvaI CCWGG 1 cut(s) 302
MwoI GCNNNNNNNGC 7 cut(s) 110, 137, 146, 155, 191, 272, 275
NspV TTCGAA 2 cut(s) 42, 245
PaeR7I CTCGAG 1 cut(s) 195
PaqCI CACCTGC 1 cut(s) 13
PcsI WCGNNNNNNNCGW 1 cut(s) 95
PfeI GAWTC 3 cut(s) 39, 56, 122
PkrI GCNGC 7 cut(s) 21, 106, 133, 193, 265, 268, 277
PleI GAGTC 1 cut(s) 161
PpsI GAGTC 1 cut(s) 161
Psp6I CCWGG 1 cut(s) 300
PspGI CCWGG 1 cut(s) 300
PspXI VCTCGAGB 1 cut(s) 195
PstNI CAGNNNCTG 1 cut(s) 272
SatI GCNGC 7 cut(s) 20, 105, 132, 192, 264, 267, 276
SchI GAGTC 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 302
SetI ASST 4 cut(s) 27, 151, 235, 306
Sfr274I CTCGAG 1 cut(s) 195
SfuI TTCGAA 2 cut(s) 42, 245
SlaI CTCGAG 1 cut(s) 195
SmlI CTYRAG 1 cut(s) 195
SmoI CTYRAG 1 cut(s) 195
Sse9I AATT 2 cut(s) 70, 75
SsiI CCGC 7 cut(s) 83, 104, 107, 113, 132, 261, 264
StyD4I CCNGG 1 cut(s) 300
TaqI TCGA 5 cut(s) 37, 42, 67, 196, 245
TaqII GACCGA 1 cut(s) 297
TasI AATT 2 cut(s) 70, 75
TauI GCSGC 3 cut(s) 107, 134, 266
TfiI GAWTC 3 cut(s) 39, 56, 122
TseI GCWGC 4 cut(s) 19, 191, 266, 275
TspDTI ATGAA 1 cut(s) 194
XapI RAATTY 1 cut(s) 70
XhoI CTCGAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.