Rmu_sc0000524.1_g000023

Caffeoylshikimate esterase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000524.1
Physical Location & Seq
Forward (+)
116579 .. 117523
945 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000524.1_g000023.1.cds

Sequence Viewer

Length: 945 bp
atggccagtgatatggggaatgtcaaatacgaagaggagtacatcttaaactctagaggaatgaagcttttcacatgcaaatggcttccggacaataacaaacctcccaaagccttgatcttcatctgccatggatatggcatggagtgtagcatcaccatgagcagtaccgcaaccagactagccaacgcagggtttgccatatacgggatagattatgaaggccatggaagatcgtcaggccttaagggctatgtcaagagttttgatcgtgttgttgacgactgcaccaaccacttcacaaacatatgtgagagcaaagagaacaaaggaaaaatgaggtatctgttgggggagtcaatgggaggagcagtggctctgcttgttcataggagaaagccacaatattgggatggtgcggtcttagttgcacccatgtgtaagattgcagatgatatgaggccatctcctattgtgatcagtcttttgaaaaaactctgcagggttatcccaacttggaaaataatccccacaaatgatatcatcgatgttgcttttagagtacccgaggttaggaaacagacgagagaaaacccttacttctacaaaggccgacctcgtctgaaaaccggctacgaacttttgagggtcagcacggatattgaacagaggcttcaagagatcacattgccgttcctagttctccatggcgaagatgataaagttaccgacacatcagttagcaaacagctctatgaggtggcctcgagttctgacaagtcactgaagttgtacccgaatatgtggcatggtctgctctatggagaactaattgagaatactgagattgtgttttcagacataatcaattggttagacaggagaaccacctccggagcttcaaggtcggagggagagttgagaagggatgatgaaaagcattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

314

Amino Acids

35.79

Weight (kDa)

8.35

Isoelectric Point (pI)

38.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 2 cut(s) 88, 893
AciI CCGC 2 cut(s) 171, 419
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 806
AfaI GTAC 4 cut(s) 41, 169, 564, 794
AfiI CCNNNNNNNGG 3 cut(s) 192, 207, 573
AflII CTTAAG 1 cut(s) 245
AgsI TTSAA 4 cut(s) 490, 665, 677, 903
AleI CACNNNNGTG 1 cut(s) 436
AluBI AGCT 3 cut(s) 67, 751, 899
AluI AGCT 3 cut(s) 67, 751, 899
Ama87I CYCGRG 2 cut(s) 566, 766
Aor13HI TCCGGA 2 cut(s) 88, 893
AoxI GGCC 6 cut(s) 3, 223, 241, 461, 610, 762
Asp700I GAANNNNTTC 1 cut(s) 68
AsuHPI GGTGA 1 cut(s) 148
AvaI CYCGRG 2 cut(s) 566, 766
BalI TGGCCA 1 cut(s) 5
BccI CCATC 2 cut(s) 407, 472
BceAI ACGGC 1 cut(s) 676
BclI TGATCA 1 cut(s) 477
BfaI CTAG 3 cut(s) 54, 182, 698
BfmI CTRYAG 1 cut(s) 499
BfrI CTTAAG 1 cut(s) 245
BglI GCCNNNNNGGC 1 cut(s) 249
BmeT110I CYCGRG 2 cut(s) 566, 766
BmsI GCATC 1 cut(s) 162
BplI GAGNNNNNCTC 4 cut(s) 451, 483, 749, 781
Bsa29I ATCGAT 1 cut(s) 546
BsaBI GATNNNNATC 1 cut(s) 122
BsaJI CCNNGG 4 cut(s) 130, 226, 567, 706
BsaWI WCCGGW 2 cut(s) 88, 893
BsaXI ACNNNNNCTCC 4 cut(s) 357, 387, 902, 932
Bsc4I CCNNNNNNNGG 3 cut(s) 192, 207, 573
Bse118I RCCGGY 1 cut(s) 629
Bse1I ACTGG 1 cut(s) 6
Bse3DI GCAATG 1 cut(s) 686
Bse8I GATNNNNATC 1 cut(s) 122
BseAI TCCGGA 2 cut(s) 88, 893
BseCI ATCGAT 1 cut(s) 546
BseDI CCNNGG 4 cut(s) 130, 226, 567, 706
BseGI GGATG 2 cut(s) 418, 934
BseJI GATNNNNATC 1 cut(s) 122
BseLI CCNNNNNNNGG 3 cut(s) 192, 207, 573
BseMI GCAATG 1 cut(s) 686
BseMII CTCAG 1 cut(s) 834
BseNI ACTGG 1 cut(s) 6
BseRI GAGGAG 2 cut(s) 50, 381
BsgI GTGCAG 1 cut(s) 271
BshFI GGCC 6 cut(s) 5, 225, 243, 463, 612, 764
BshVI ATCGAT 1 cut(s) 546
BsiHKCI CYCGRG 2 cut(s) 566, 766
BsiSI CCGG 3 cut(s) 89, 630, 894
BslI CCNNNNNNNGG 3 cut(s) 192, 207, 573
BsnI GGCC 6 cut(s) 5, 225, 243, 463, 612, 764
BsoBI CYCGRG 2 cut(s) 566, 766
Bsp13I TCCGGA 2 cut(s) 88, 893
Bsp143I GATC 5 cut(s) 117, 233, 268, 477, 681
Bsp19I CCATGG 3 cut(s) 130, 226, 706
BspACI CCGC 2 cut(s) 171, 419
BspANI GGCC 6 cut(s) 5, 225, 243, 463, 612, 764
BspCNI CTCAG 1 cut(s) 835
BspDI ATCGAT 1 cut(s) 546
BspEI TCCGGA 2 cut(s) 88, 893
BspMAI CTGCAG 1 cut(s) 503
BspTI CTTAAG 1 cut(s) 245
BsrDI GCAATG 1 cut(s) 686
BsrFI RCCGGY 1 cut(s) 629
BsrI ACTGG 1 cut(s) 6
BssAI RCCGGY 1 cut(s) 629
BssECI CCNNGG 4 cut(s) 130, 226, 567, 706
BssMI GATC 5 cut(s) 117, 233, 268, 477, 681
BssT1I CCWWGG 3 cut(s) 130, 226, 706
Bst6I CTCTTC 1 cut(s) 27
BstAFI CTTAAG 1 cut(s) 245
BstAPI GCANNNNNTGC 2 cut(s) 197, 814
BstDEI CTNAG 2 cut(s) 424, 843
BstDSI CCRYGG 3 cut(s) 130, 226, 706
BstF5I GGATG 2 cut(s) 418, 934
BstKTI GATC 5 cut(s) 120, 236, 271, 480, 684
BstMBI GATC 5 cut(s) 117, 233, 268, 477, 681
BstMWI GCNNNNNNNGC 3 cut(s) 197, 249, 814
BstNSI RCATGY 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 499
BstXI CCANNNNNNTGG 3 cut(s) 13, 137, 408
Bsu15I ATCGAT 1 cut(s) 546
BsuRI GGCC 6 cut(s) 5, 225, 243, 463, 612, 764
BsuTUI ATCGAT 1 cut(s) 546
BtgI CCRYGG 3 cut(s) 130, 226, 706
BtsCI GGATG 2 cut(s) 418, 934
BtsI GCAGTG 1 cut(s) 378
BtsIMutI CAGTG 3 cut(s) 13, 378, 782
Cfr10I RCCGGY 1 cut(s) 629
ClaI ATCGAT 1 cut(s) 546
Csp6I GTAC 4 cut(s) 40, 168, 563, 793
CviAII CATG 8 cut(s) 75, 131, 142, 160, 227, 436, 707, 809
CviQI GTAC 4 cut(s) 40, 168, 563, 793
DdeI CTNAG 2 cut(s) 424, 843
DpnI GATC 5 cut(s) 119, 235, 270, 479, 683
DpnII GATC 5 cut(s) 117, 233, 268, 477, 681
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
Eco130I CCWWGG 3 cut(s) 130, 226, 706
Eco147I AGGCCT 1 cut(s) 243
Eco32I GATATC 1 cut(s) 541
Eco57I CTGAAG 1 cut(s) 806
Eco88I CYCGRG 2 cut(s) 566, 766
EcoRV GATATC 1 cut(s) 541
EcoT14I CCWWGG 3 cut(s) 130, 226, 706
ErhI CCWWGG 3 cut(s) 130, 226, 706
FaeI CATG 8 cut(s) 78, 134, 145, 163, 230, 439, 710, 812
FatI CATG 8 cut(s) 74, 130, 141, 159, 226, 435, 706, 808
FauNDI CATATG 1 cut(s) 308
FbaI TGATCA 1 cut(s) 477
FokI GGATG 2 cut(s) 425, 941
FspBI CTAG 3 cut(s) 54, 182, 698
HaeIII GGCC 6 cut(s) 5, 225, 243, 463, 612, 764
HapII CCGG 3 cut(s) 89, 630, 894
Hin1II CATG 8 cut(s) 78, 134, 145, 163, 230, 439, 710, 812
HincII GTYRAC 1 cut(s) 280
HindII GTYRAC 1 cut(s) 280
HindIII AAGCTT 1 cut(s) 65
HinfI GANTC 1 cut(s) 356
HpaII CCGG 3 cut(s) 89, 630, 894
HphI GGTGA 1 cut(s) 148
Hpy166II GTNNAC 1 cut(s) 280
Hpy188I TCNGA 4 cut(s) 624, 775, 859, 910
Hpy188III TCNNGA 5 cut(s) 54, 89, 259, 677, 894
Hpy8I GTNNAC 1 cut(s) 280
HpyAV CCTTC 2 cut(s) 215, 918
HpyCH4V TGCA 5 cut(s) 78, 288, 431, 449, 501
HpyF10VI GCNNNNNNNGC 3 cut(s) 197, 249, 814
HpyF3I CTNAG 2 cut(s) 424, 843
Hsp92II CATG 8 cut(s) 78, 134, 145, 163, 230, 439, 710, 812
Kpn2I TCCGGA 2 cut(s) 88, 893
Ksp22I TGATCA 1 cut(s) 477
Kzo9I GATC 5 cut(s) 117, 233, 268, 477, 681
LmnI GCTCC 2 cut(s) 368, 896
LpnPI CCDG 9 cut(s) 19, 102, 177, 190, 225, 487, 643, 865, 907
LweI GCATC 1 cut(s) 162
MaeI CTAG 3 cut(s) 54, 182, 698
MaeIII GTNAC 2 cut(s) 724, 780
MalI GATC 5 cut(s) 119, 235, 270, 479, 683
MboI GATC 5 cut(s) 117, 233, 268, 477, 681
MboII GAAGA 4 cut(s) 44, 112, 243, 725
MfeI CAATTG 1 cut(s) 868
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 831, 868
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 365
MmeI TCCRAC 1 cut(s) 888
Mox20I TGGCCA 1 cut(s) 5
MroI TCCGGA 2 cut(s) 88, 893
MroXI GAANNNNTTC 1 cut(s) 68
MscI TGGCCA 1 cut(s) 5
MseI TTAA 3 cut(s) 47, 246, 943
MslI CAYNNNNRTG 4 cut(s) 79, 135, 158, 436
Msp20I TGGCCA 1 cut(s) 5
MspCI CTTAAG 1 cut(s) 245
MspI CCGG 3 cut(s) 89, 630, 894
MunI CAATTG 1 cut(s) 868
MwoI GCNNNNNNNGC 3 cut(s) 197, 249, 814
NcoI CCATGG 3 cut(s) 130, 226, 706
NdeI CATATG 1 cut(s) 308
NdeII GATC 5 cut(s) 117, 233, 268, 477, 681
NlaIII CATG 8 cut(s) 78, 134, 145, 163, 230, 439, 710, 812
NmuCI GTSAC 1 cut(s) 780
NspI RCATGY 1 cut(s) 78
OliI CACNNNNGTG 1 cut(s) 436
PaeR7I CTCGAG 1 cut(s) 766
PceI AGGCCT 1 cut(s) 243
PdmI GAANNNNTTC 1 cut(s) 68
PflFI GACNNNGTC 1 cut(s) 618
PleI GAGTC 1 cut(s) 364
PpsI GAGTC 1 cut(s) 364
PspXI VCTCGAGB 1 cut(s) 766
PstI CTGCAG 1 cut(s) 503
PsyI GACNNNGTC 1 cut(s) 618
RsaI GTAC 4 cut(s) 41, 169, 564, 794
RsaNI GTAC 4 cut(s) 40, 168, 563, 793
RseI CAYNNNNRTG 4 cut(s) 79, 135, 158, 436
SaqAI TTAA 3 cut(s) 47, 246, 943
Sau3AI GATC 5 cut(s) 117, 233, 268, 477, 681
SchI GAGTC 1 cut(s) 365
SfaNI GCATC 1 cut(s) 162
SfcI CTRYAG 1 cut(s) 499
Sfr274I CTCGAG 1 cut(s) 766
SlaI CTCGAG 1 cut(s) 766
SmiMI CAYNNNNRTG 4 cut(s) 79, 135, 158, 436
SmlI CTYRAG 2 cut(s) 245, 766
SmoI CTYRAG 2 cut(s) 245, 766
Sse9I AATT 2 cut(s) 831, 868
SseBI AGGCCT 1 cut(s) 243
SsiI CCGC 2 cut(s) 171, 419
SspI AATATT 1 cut(s) 407
SspMI CTAG 3 cut(s) 54, 182, 698
StuI AGGCCT 1 cut(s) 243
StyI CCWWGG 3 cut(s) 130, 226, 706
TaqI TCGA 2 cut(s) 546, 767
TasI AATT 2 cut(s) 831, 868
TatI WGTACW 1 cut(s) 39
Tru1I TTAA 3 cut(s) 47, 246, 943
Tru9I TTAA 3 cut(s) 47, 246, 943
TscAI CASTG 3 cut(s) 13, 378, 789
TseFI GTSAC 1 cut(s) 780
Tsp45I GTSAC 1 cut(s) 780
TspDTI ATGAA 4 cut(s) 77, 112, 234, 377
TspGWI ACGGA 1 cut(s) 671
TspRI CASTG 3 cut(s) 13, 378, 789
Tth111I GACNNNGTC 1 cut(s) 618
Vha464I CTTAAG 1 cut(s) 245
XbaI TCTAGA 1 cut(s) 53
XceI RCATGY 1 cut(s) 78
XhoI CTCGAG 1 cut(s) 766
XmnI GAANNNNTTC 1 cut(s) 68
XspI CTAG 3 cut(s) 54, 182, 698
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.