Rmu_sc0000639.1_g000010

Monothiol

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000639.1
OG0004905
Physical Location & Seq
Reverse (-)
55684 .. 55983
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000639.1_g000010.1.cds

Sequence Viewer

Length: 300 bp
atggtgactggaaagccagtggtgatcttcagcaggagcacatgttgcatgagccactccatcaggtcactgataacagggtacggggcgaatccaacagtgtatgagcttgatcaaatcccaaatgggcaagtaatagagagggtactagttgagcaactgaaatgcgagccaagtgtgccagctgttttcataggccaacagttcgttggtggagctaatcaggtcatgaccctccaactcagaaaccagcttgcgcccaggctcctagcggccaatgccatttgggtttggaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glutaredoxin

Protein Analysis

99

Amino Acids

10.88

Weight (kDa)

8.61

Isoelectric Point (pI)

38.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 272
AcoI YGGCCR 1 cut(s) 273
AcuI CTGAAG 1 cut(s) 13
AfaI GTAC 2 cut(s) 83, 147
AflIII ACRYGT 1 cut(s) 41
AhlI ACTAGT 1 cut(s) 148
AjnI CCWGG 1 cut(s) 260
AluBI AGCT 4 cut(s) 109, 185, 218, 253
AluI AGCT 4 cut(s) 109, 185, 218, 253
Alw21I GWGCWC 1 cut(s) 41
AoxI GGCC 2 cut(s) 196, 273
AspLEI GCGC 1 cut(s) 259
AsuHPI GGTGA 2 cut(s) 16, 34
Bbv12I GWGCWC 1 cut(s) 41
BccI CCATC 1 cut(s) 68
BciT130I CCWGG 1 cut(s) 262
BclI TGATCA 1 cut(s) 112
BcuI ACTAGT 1 cut(s) 148
BfaI CTAG 2 cut(s) 149, 269
BisI GCNGC 1 cut(s) 273
BlsI GCNGC 1 cut(s) 274
Bme1390I CCNGG 1 cut(s) 262
BmiI GGNNCC 1 cut(s) 266
BmrFI CCNGG 1 cut(s) 262
BsaJI CCNNGG 1 cut(s) 260
BsaXI ACNNNNNCTCC 2 cut(s) 28, 58
Bse1I ACTGG 2 cut(s) 13, 17
BseBI CCWGG 1 cut(s) 262
BseDI CCNNGG 1 cut(s) 260
BseMII CTCAG 1 cut(s) 256
BseNI ACTGG 2 cut(s) 13, 17
BshFI GGCC 2 cut(s) 198, 275
BsiHKAI GWGCWC 1 cut(s) 41
BsnI GGCC 2 cut(s) 198, 275
Bsp1286I GDGCHC 1 cut(s) 41
Bsp143I GATC 2 cut(s) 24, 112
BspACI CCGC 1 cut(s) 272
BspANI GGCC 2 cut(s) 198, 275
BspCNI CTCAG 1 cut(s) 255
BspHI TCATGA 1 cut(s) 228
BspLI GGNNCC 1 cut(s) 266
BsrI ACTGG 2 cut(s) 13, 17
BssECI CCNNGG 1 cut(s) 260
BssMI GATC 2 cut(s) 24, 112
Bst2UI CCWGG 1 cut(s) 262
Bst4CI ACNGT 2 cut(s) 100, 204
BstAPI GCANNNNNTGC 1 cut(s) 45
BstC8I GCNNGC 3 cut(s) 170, 183, 255
BstDEI CTNAG 1 cut(s) 242
BstHHI GCGC 1 cut(s) 259
BstKTI GATC 2 cut(s) 27, 115
BstMBI GATC 2 cut(s) 24, 112
BstMWI GCNNNNNNNGC 3 cut(s) 45, 178, 278
BstNI CCWGG 1 cut(s) 262
BstNSI RCATGY 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 260
BsuRI GGCC 2 cut(s) 198, 275
BtsIMutI CAGTG 3 cut(s) 24, 68, 105
Cac8I GCNNGC 3 cut(s) 170, 183, 255
CciI TCATGA 1 cut(s) 228
CfoI GCGC 1 cut(s) 259
Csp6I GTAC 2 cut(s) 82, 146
CviAII CATG 3 cut(s) 42, 49, 229
CviQI GTAC 2 cut(s) 82, 146
DdeI CTNAG 1 cut(s) 242
DpnI GATC 2 cut(s) 26, 114
DpnII GATC 2 cut(s) 24, 112
EaeI YGGCCR 1 cut(s) 273
Eco57I CTGAAG 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 260
FaeI CATG 3 cut(s) 45, 52, 232
FaiI YATR 5 cut(s) 43, 50, 105, 194, 230
FatI CATG 3 cut(s) 41, 48, 228
FbaI TGATCA 1 cut(s) 112
Fnu4HI GCNGC 1 cut(s) 273
Fsp4HI GCNGC 1 cut(s) 273
FspBI CTAG 2 cut(s) 149, 269
GlaI GCGC 1 cut(s) 258
GluI GCNGC 1 cut(s) 273
HaeIII GGCC 2 cut(s) 198, 275
HhaI GCGC 1 cut(s) 259
Hin1II CATG 3 cut(s) 45, 52, 232
Hin6I GCGC 1 cut(s) 257
HinP1I GCGC 1 cut(s) 257
HinfI GANTC 1 cut(s) 91
HphI GGTGA 2 cut(s) 16, 34
Hpy188I TCNGA 1 cut(s) 245
Hpy188III TCNNGA 1 cut(s) 229
HpyCH4III ACNGT 2 cut(s) 100, 204
HpyCH4V TGCA 1 cut(s) 48
HpyF10VI GCNNNNNNNGC 3 cut(s) 45, 178, 278
HpyF3I CTNAG 1 cut(s) 242
Hsp92II CATG 3 cut(s) 45, 52, 232
HspAI GCGC 1 cut(s) 257
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 2 cut(s) 24, 112
LmnI GCTCC 3 cut(s) 36, 215, 270
LpnPI CCDG 9 cut(s) 19, 30, 49, 63, 195, 209, 247, 263, 274
MaeI CTAG 2 cut(s) 149, 269
MaeIII GTNAC 2 cut(s) 4, 66
MalI GATC 2 cut(s) 26, 114
MboI GATC 2 cut(s) 24, 112
MboII GAAGA 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 41
MmeI TCCRAC 2 cut(s) 119, 262
MnlI CCTC 2 cut(s) 135, 245
MspA1I CMGCKG 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 262
MvaI CCWGG 1 cut(s) 262
MwoI GCNNNNNNNGC 3 cut(s) 45, 178, 278
NdeII GATC 2 cut(s) 24, 112
NlaIII CATG 3 cut(s) 45, 52, 232
NlaIV GGNNCC 1 cut(s) 266
NmuCI GTSAC 2 cut(s) 4, 66
NspI RCATGY 1 cut(s) 45
PagI TCATGA 1 cut(s) 228
PciI ACATGT 1 cut(s) 41
PfeI GAWTC 1 cut(s) 91
PkrI GCNGC 1 cut(s) 274
PscI ACATGT 1 cut(s) 41
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
PspN4I GGNNCC 1 cut(s) 266
PvuII CAGCTG 1 cut(s) 185
RsaI GTAC 2 cut(s) 83, 147
RsaNI GTAC 2 cut(s) 82, 146
SatI GCNGC 1 cut(s) 273
Sau3AI GATC 2 cut(s) 24, 112
ScrFI CCNGG 1 cut(s) 262
SduI GDGCHC 1 cut(s) 41
SetI ASST 6 cut(s) 68, 111, 187, 220, 228, 255
SpeI ACTAGT 1 cut(s) 148
SsiI CCGC 1 cut(s) 272
SspMI CTAG 2 cut(s) 149, 269
StyD4I CCNGG 1 cut(s) 260
TaaI ACNGT 2 cut(s) 100, 204
TauI GCSGC 1 cut(s) 275
TfiI GAWTC 1 cut(s) 91
TscAI CASTG 3 cut(s) 24, 75, 105
TseFI GTSAC 2 cut(s) 4, 66
Tsp45I GTSAC 2 cut(s) 4, 66
TspDTI ATGAA 1 cut(s) 181
TspRI CASTG 3 cut(s) 24, 75, 105
XceI RCATGY 1 cut(s) 45
XcmI CCANNNNNNNNNTGG 1 cut(s) 206
XspI CTAG 2 cut(s) 149, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.