Rmu_sc0001788.1_g000011

Monothiol

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001788.1
Physical Location & Seq
Reverse (-)
70163 .. 70462
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001788.1_g000011.1.cds

Sequence Viewer

Length: 300 bp
atggtgaccggaaagccagtggtgatattcagcaagagcacatgttgcatgagccactccatcagctcactgataacagggtacggggcgaatccaacagtgtatgagcttgatcaaatcccaaatgggcaagtaatagagagggtgctagttgagcagctgaaatgcgagccaagtgtgccagctgttttcataggccaacagttcgttggtggagctaatcaggtcatgaccctccaactcagaaaccagcttgcccctaggctcctagaggccaatgccatttgggtttggaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

10.85

Weight (kDa)

6.53

Isoelectric Point (pI)

29.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 83
AflIII ACRYGT 1 cut(s) 41
AluBI AGCT 6 cut(s) 66, 109, 160, 185, 218, 253
AluI AGCT 6 cut(s) 66, 109, 160, 185, 218, 253
Alw21I GWGCWC 1 cut(s) 41
AoxI GGCC 2 cut(s) 196, 273
ApeKI GCWGC 1 cut(s) 157
AspA2I CCTAGG 1 cut(s) 260
AsuHPI GGTGA 2 cut(s) 16, 34
AvrII CCTAGG 1 cut(s) 260
Bbv12I GWGCWC 1 cut(s) 41
BbvI GCAGC 1 cut(s) 169
BccI CCATC 1 cut(s) 68
BclI TGATCA 1 cut(s) 112
BfaI CTAG 3 cut(s) 149, 261, 269
BisI GCNGC 1 cut(s) 158
BlnI CCTAGG 1 cut(s) 260
BlsI GCNGC 1 cut(s) 159
BmiI GGNNCC 1 cut(s) 266
BsaJI CCNNGG 1 cut(s) 260
BsaWI WCCGGW 1 cut(s) 8
Bse1I ACTGG 1 cut(s) 17
BseDI CCNNGG 1 cut(s) 260
BseMII CTCAG 1 cut(s) 256
BseNI ACTGG 1 cut(s) 17
BseXI GCAGC 1 cut(s) 169
BshFI GGCC 2 cut(s) 198, 275
BsiHKAI GWGCWC 1 cut(s) 41
BsiSI CCGG 1 cut(s) 9
BsnI GGCC 2 cut(s) 198, 275
Bsp1286I GDGCHC 1 cut(s) 41
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 2 cut(s) 198, 275
BspCNI CTCAG 1 cut(s) 255
BspHI TCATGA 1 cut(s) 228
BspLI GGNNCC 1 cut(s) 266
BsrI ACTGG 1 cut(s) 17
BssECI CCNNGG 1 cut(s) 260
BssMI GATC 1 cut(s) 112
BssT1I CCWWGG 1 cut(s) 260
Bst4CI ACNGT 2 cut(s) 100, 204
BstAPI GCANNNNNTGC 1 cut(s) 45
BstC8I GCNNGC 3 cut(s) 170, 183, 255
BstDEI CTNAG 1 cut(s) 242
BstEII GGTNACC 1 cut(s) 4
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 3 cut(s) 45, 154, 178
BstNSI RCATGY 1 cut(s) 45
BstPI GGTNACC 1 cut(s) 4
BstV1I GCAGC 1 cut(s) 169
BsuRI GGCC 2 cut(s) 198, 275
BtsIMutI CAGTG 3 cut(s) 24, 68, 105
Cac8I GCNNGC 3 cut(s) 170, 183, 255
CciI TCATGA 1 cut(s) 228
Csp6I GTAC 1 cut(s) 82
CviAII CATG 3 cut(s) 42, 49, 229
CviQI GTAC 1 cut(s) 82
DdeI CTNAG 1 cut(s) 242
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco130I CCWWGG 1 cut(s) 260
Eco91I GGTNACC 1 cut(s) 4
EcoO65I GGTNACC 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 260
ErhI CCWWGG 1 cut(s) 260
FaeI CATG 3 cut(s) 45, 52, 232
FaiI YATR 5 cut(s) 43, 50, 105, 194, 230
FatI CATG 3 cut(s) 41, 48, 228
FbaI TGATCA 1 cut(s) 112
Fnu4HI GCNGC 1 cut(s) 158
Fsp4HI GCNGC 1 cut(s) 158
FspBI CTAG 3 cut(s) 149, 261, 269
GluI GCNGC 1 cut(s) 158
HaeIII GGCC 2 cut(s) 198, 275
HapII CCGG 1 cut(s) 9
Hin1II CATG 3 cut(s) 45, 52, 232
HinfI GANTC 1 cut(s) 91
HpaII CCGG 1 cut(s) 9
HphI GGTGA 2 cut(s) 16, 34
Hpy188I TCNGA 1 cut(s) 245
Hpy188III TCNNGA 1 cut(s) 229
HpyCH4III ACNGT 2 cut(s) 100, 204
HpyCH4V TGCA 1 cut(s) 48
HpyF10VI GCNNNNNNNGC 3 cut(s) 45, 154, 178
HpyF3I CTNAG 1 cut(s) 242
Hsp92II CATG 3 cut(s) 45, 52, 232
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 1 cut(s) 112
LmnI GCTCC 2 cut(s) 215, 270
LpnPI CCDG 6 cut(s) 22, 30, 63, 195, 209, 263
Lsp1109I GCAGC 1 cut(s) 169
MaeI CTAG 3 cut(s) 149, 261, 269
MaeIII GTNAC 1 cut(s) 4
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MhlI GDGCHC 1 cut(s) 41
MmeI TCCRAC 2 cut(s) 119, 262
MnlI CCTC 3 cut(s) 135, 245, 265
MspA1I CMGCKG 2 cut(s) 160, 185
MspI CCGG 1 cut(s) 9
MwoI GCNNNNNNNGC 3 cut(s) 45, 154, 178
NdeII GATC 1 cut(s) 112
NlaIII CATG 3 cut(s) 45, 52, 232
NlaIV GGNNCC 1 cut(s) 266
NmuCI GTSAC 1 cut(s) 4
NspI RCATGY 1 cut(s) 45
PagI TCATGA 1 cut(s) 228
PciI ACATGT 1 cut(s) 41
PfeI GAWTC 1 cut(s) 91
PkrI GCNGC 1 cut(s) 159
PscI ACATGT 1 cut(s) 41
PspEI GGTNACC 1 cut(s) 4
PspN4I GGNNCC 1 cut(s) 266
PvuII CAGCTG 2 cut(s) 160, 185
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SatI GCNGC 1 cut(s) 158
Sau3AI GATC 1 cut(s) 112
SduI GDGCHC 1 cut(s) 41
SetI ASST 7 cut(s) 68, 111, 162, 187, 220, 228, 255
SspMI CTAG 3 cut(s) 149, 261, 269
StyI CCWWGG 1 cut(s) 260
TaaI ACNGT 2 cut(s) 100, 204
TfiI GAWTC 1 cut(s) 91
TscAI CASTG 3 cut(s) 24, 75, 105
TseFI GTSAC 1 cut(s) 4
TseI GCWGC 1 cut(s) 157
Tsp45I GTSAC 1 cut(s) 4
TspDTI ATGAA 1 cut(s) 181
TspRI CASTG 3 cut(s) 24, 75, 105
XceI RCATGY 1 cut(s) 45
XcmI CCANNNNNNNNNTGG 1 cut(s) 206
XmaJI CCTAGG 1 cut(s) 260
XspI CTAG 3 cut(s) 149, 261, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.