Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000882.1

Orthogroup ID

OG0008387

Physical Location & Seq

Genomic Coordinates Reverse (-)

84734 .. 86871

Gene Structure 2138 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000882.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 750 bp

atgaattctgtgtgcagagcattatgccgtgagcctggtgttgaaagtaagtttgggacaagtgttggaagattggagtggctagaggatcaaaatttgtggtcattgattggtttggatggacaaaatcttggtcagtttaagggagtggttgcaacagacaaaaacatagtttcacccaggtttacaagtgttacaggaaaaccactacctcttgatttgaaattatttccagagttagcagttaagttgaatgacattcctgttcgtccgtgctttgctctaatgatagcctttgcagaacctctgacatcgataccctttaaaggcttctcaataaaaaattctgaagttttaagctgggctcattgtgatagcagcaagcctggccgttctacctctagtgagcgatgggttctgcattctacaatggagtatgctcagagaataattgctcaaactggacttcagaagctttcagatgcaacactgaccaaagtggctgaagaactattccaagaattacaaagcctgggacttaatatttcacagccctttttcaagaaagctcatagatggggaagtgcttttccagctacaagcatagccagagaggagaaatgtctttgggatgggaacaagaggtttgccatctgcggtgatttctgtgttagtccagatgttgaaggtgctatagttagtggcctggccgcagcttccaaactttcagaggtcttcagctgcttatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Amino_oxidase NAD_binding_8

Protein Analysis

249

Amino Acids

27.33

Weight (kDa)

7.54

Isoelectric Point (pI)

42.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008387)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G55980 AT1G55980 AT1G55980 AT1G56000 AT1G56000
fragaria_vesca	FvH4_3g16060
malus_domestica	MD05G1215100.v1.1
prunus_persica	Prupe.4G143800_v2.0.a1 Prupe.4G143800_v2.0.a1
pyrus_communis	pycom05g19810
rosa_chinensis	RchiOBHm_Chr5g0027031
rosa_laevigata	RLG00000032980 RLG00000032984
rosa_multiflora	Rmu_sc0000882.1_g000020 Rmu_sc0020999.1_g000001 Rmu_sc0021000.1_g000001
rosa_roxburghii	Rroxscaffold_1G00052460
rosa_rugosa	Rorug05G0096700
rosa_samantha	Rh5AG190300 Rh5BG187900 Rh5CG207700 Rh5DG189700
rosa_wichuraiana	Rw5G017330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	657, 711
AclWI	GGATC	1 cut(s)	96
AcoI	YGGCCR	2 cut(s)	388, 708
AcsI	RAATTY	3 cut(s)	4, 94, 343
AcuI	CTGAAG	4 cut(s)	369, 452, 525, 721
AfiI	CCNNNNNNNGG	1 cut(s)	326
AgsI	TTSAA	5 cut(s)	44, 223, 253, 562, 686
AjnI	CCWGG	5 cut(s)	34, 179, 385, 531, 705
AjuI	GAANNNNNNNTTGG	2 cut(s)	36, 68
AluBI	AGCT	6 cut(s)	360, 475, 569, 596, 716, 741
AluI	AGCT	6 cut(s)	360, 475, 569, 596, 716, 741
AlwI	GGATC	1 cut(s)	96
AoxI	GGCC	3 cut(s)	388, 703, 708
ApeKI	GCWGC	3 cut(s)	378, 713, 741
ApoI	RAATTY	3 cut(s)	4, 94, 343
ArsI	GACNNNNNNTTYG	2 cut(s)	118, 150
AsuHPI	GGTGA	2 cut(s)	168, 671
BanII	GRGCYC	1 cut(s)	367
BbsI	GAAGAC	1 cut(s)	727
BbvI	GCAGC	3 cut(s)	390, 725, 728
BccI	CCATC	5 cut(s)	113, 405, 570, 626, 659
BceAI	ACGGC	2 cut(s)	12, 375
BciT130I	CCWGG	5 cut(s)	36, 181, 387, 533, 707
BfaI	CTAG	2 cut(s)	83, 402
BfmI	CTRYAG	1 cut(s)	693
BisI	GCNGC	4 cut(s)	379, 711, 714, 742
BlsI	GCNGC	4 cut(s)	380, 712, 715, 743
Bme1390I	CCNGG	5 cut(s)	36, 181, 387, 533, 707
BmrFI	CCNGG	5 cut(s)	36, 181, 387, 533, 707
BmsI	GCATC	1 cut(s)	472
BpiI	GAAGAC	1 cut(s)	727
Bsa29I	ATCGAT	1 cut(s)	314
BsaJI	CCNNGG	2 cut(s)	179, 532
Bsc4I	CCNNNNNNNGG	1 cut(s)	326
Bse1I	ACTGG	1 cut(s)	466
BseBI	CCWGG	5 cut(s)	36, 181, 387, 533, 707
BseCI	ATCGAT	1 cut(s)	314
BseDI	CCNNGG	2 cut(s)	179, 532
BseGI	GGATG	2 cut(s)	124, 637
BseLI	CCNNNNNNNGG	1 cut(s)	326
BseMII	CTCAG	1 cut(s)	455
BseNI	ACTGG	1 cut(s)	466
BseRI	GAGGAG	1 cut(s)	629
BseXI	GCAGC	3 cut(s)	390, 725, 728
BseYI	CCCAGC	1 cut(s)	360
BsgI	GTGCAG	1 cut(s)	34
BshFI	GGCC	3 cut(s)	390, 705, 710
BshVI	ATCGAT	1 cut(s)	314
BslFI	GGGAC	2 cut(s)	70, 549
BslI	CCNNNNNNNGG	1 cut(s)	326
BsmFI	GGGAC	2 cut(s)	70, 549
BsmI	GAATGC	1 cut(s)	421
BsnI	GGCC	3 cut(s)	390, 705, 710
Bsp1286I	GDGCHC	1 cut(s)	367
Bsp143I	GATC	1 cut(s)	88
BspACI	CCGC	2 cut(s)	657, 711
BspANI	GGCC	3 cut(s)	390, 705, 710
BspCNI	CTCAG	1 cut(s)	454
BspDI	ATCGAT	1 cut(s)	314
BspPI	GGATC	1 cut(s)	96
BsrI	ACTGG	1 cut(s)	466
BssECI	CCNNGG	2 cut(s)	179, 532
BssMI	GATC	1 cut(s)	88
Bst2UI	CCWGG	5 cut(s)	36, 181, 387, 533, 707
BstC8I	GCNNGC	1 cut(s)	383
BstDEI	CTNAG	1 cut(s)	441
BstF5I	GGATG	2 cut(s)	124, 637
BstKTI	GATC	1 cut(s)	91
BstMBI	GATC	1 cut(s)	88
BstMWI	GCNNNNNNNGC	2 cut(s)	387, 593
BstNI	CCWGG	5 cut(s)	36, 181, 387, 533, 707
BstSCI	CCNGG	5 cut(s)	34, 179, 385, 531, 705
BstSFI	CTRYAG	1 cut(s)	693
BstV1I	GCAGC	3 cut(s)	390, 725, 728
BstV2I	GAAGAC	1 cut(s)	727
Bsu15I	ATCGAT	1 cut(s)	314
BsuRI	GGCC	3 cut(s)	390, 705, 710
BsuTUI	ATCGAT	1 cut(s)	314
BtgZI	GCGATG	1 cut(s)	424
BtsCI	GGATG	2 cut(s)	124, 637
BtsIMutI	CAGTG	1 cut(s)	488
Cac8I	GCNNGC	1 cut(s)	383
ClaI	ATCGAT	1 cut(s)	314
CspCI	CAANNNNNGTGG	2 cut(s)	80, 115
DdeI	CTNAG	1 cut(s)	441
DpnI	GATC	1 cut(s)	90
DpnII	GATC	1 cut(s)	88
DraI	TTTAAA	1 cut(s)	325
EaeI	YGGCCR	2 cut(s)	388, 708
Eco24I	GRGCYC	1 cut(s)	367
Eco57I	CTGAAG	4 cut(s)	369, 452, 525, 721
EcoRI	GAATTC	1 cut(s)	4
EcoRII	CCWGG	5 cut(s)	34, 179, 385, 531, 705
EcoT38I	GRGCYC	1 cut(s)	367
FaiI	YATR	7 cut(s)	25, 170, 438, 573, 605, 695, 748
FaqI	GGGAC	2 cut(s)	70, 549
Fnu4HI	GCNGC	4 cut(s)	379, 711, 714, 742
FokI	GGATG	2 cut(s)	131, 644
FriOI	GRGCYC	1 cut(s)	367
Fsp4HI	GCNGC	4 cut(s)	379, 711, 714, 742
FspBI	CTAG	2 cut(s)	83, 402
GluI	GCNGC	4 cut(s)	379, 711, 714, 742
GsaI	CCCAGC	1 cut(s)	364
HaeIII	GGCC	3 cut(s)	390, 705, 710
HindIII	AAGCTT	1 cut(s)	473
HphI	GGTGA	2 cut(s)	168, 671
Hpy166II	GTNNAC	1 cut(s)	186
Hpy188I	TCNGA	6 cut(s)	309, 349, 444, 471, 481, 730
Hpy188III	TCNNGA	4 cut(s)	215, 233, 562, 677
Hpy8I	GTNNAC	1 cut(s)	186
HpyAV	CCTTC	1 cut(s)	680
HpyCH4V	TGCA	5 cut(s)	15, 155, 299, 421, 485
HpyF10VI	GCNNNNNNNGC	2 cut(s)	387, 593
HpyF3I	CTNAG	1 cut(s)	441
Kzo9I	GATC	1 cut(s)	88
Lsp1109I	GCAGC	3 cut(s)	390, 725, 728
LweI	GCATC	1 cut(s)	472
MaeI	CTAG	2 cut(s)	83, 402
MaeIII	GTNAC	1 cut(s)	193
MalI	GATC	1 cut(s)	90
MboI	GATC	1 cut(s)	88
MboII	GAAGA	3 cut(s)	81, 518, 727
MhlI	GDGCHC	1 cut(s)	367
MluCI	AATT	6 cut(s)	4, 94, 224, 343, 450, 521
MmeI	TCCRAC	1 cut(s)	46
MnlI	CCTC	7 cut(s)	79, 222, 315, 409, 607, 636, 724
MseI	TTAA	5 cut(s)	141, 246, 324, 356, 540
MspA1I	CMGCKG	1 cut(s)	741
MspR9I	CCNGG	5 cut(s)	36, 181, 387, 533, 707
Mva1269I	GAATGC	1 cut(s)	421
MvaI	CCWGG	5 cut(s)	36, 181, 387, 533, 707
MwoI	GCNNNNNNNGC	2 cut(s)	387, 593
NdeII	GATC	1 cut(s)	88
PctI	GAATGC	1 cut(s)	421
PkrI	GCNGC	4 cut(s)	380, 712, 715, 743
Psp6I	CCWGG	5 cut(s)	34, 179, 385, 531, 705
PspFI	CCCAGC	1 cut(s)	360
PspGI	CCWGG	5 cut(s)	34, 179, 385, 531, 705
PvuII	CAGCTG	1 cut(s)	741
SaqAI	TTAA	5 cut(s)	141, 246, 324, 356, 540
SatI	GCNGC	4 cut(s)	379, 711, 714, 742
Sau3AI	GATC	1 cut(s)	88
ScrFI	CCNGG	5 cut(s)	36, 181, 387, 533, 707
SduI	GDGCHC	1 cut(s)	367
SfaNI	GCATC	1 cut(s)	472
SfcI	CTRYAG	1 cut(s)	693
Sse9I	AATT	6 cut(s)	4, 94, 224, 343, 450, 521
SsiI	CCGC	2 cut(s)	657, 711
SspI	AATATT	1 cut(s)	544
SspMI	CTAG	2 cut(s)	83, 402
StyD4I	CCNGG	5 cut(s)	34, 179, 385, 531, 705
TaqI	TCGA	1 cut(s)	314
TasI	AATT	6 cut(s)	4, 94, 224, 343, 450, 521
TauI	GCSGC	1 cut(s)	713
Tru1I	TTAA	5 cut(s)	141, 246, 324, 356, 540
Tru9I	TTAA	5 cut(s)	141, 246, 324, 356, 540
TscAI	CASTG	1 cut(s)	495
TseI	GCWGC	3 cut(s)	378, 713, 741
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	261
TspRI	CASTG	1 cut(s)	495
XapI	RAATTY	3 cut(s)	4, 94, 343
XspI	CTAG	2 cut(s)	83, 402

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.