Rmu_sc0021000.1_g000001

NAD(P)-binding Rossmann-like domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021000.1
Physical Location & Seq
Reverse (-)
1 .. 500
500 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021000.1_g000001.1.cds

Sequence Viewer

Length: 217 bp
atgaattctgtgtgcagagcattatgccgtgagcctggtgttgaaagtaagtttgggacaagtgttggaagattggagtggctagaggatcaaaatttgtggtcattgattggtttggatggacaaaatcttggtcagtttaagggagtggttgcaacagacaaaaacatagtttcacccaggtttacaagtgttacaggaaaaccactacctcttg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.86

Weight (kDa)

7.79

Isoelectric Point (pI)

21.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 96
AcsI RAATTY 2 cut(s) 4, 94
AgsI TTSAA 1 cut(s) 44
AjnI CCWGG 2 cut(s) 34, 179
AjuI GAANNNNNNNTTGG 2 cut(s) 36, 68
AlwI GGATC 1 cut(s) 96
ApoI RAATTY 2 cut(s) 4, 94
ArsI GACNNNNNNTTYG 2 cut(s) 118, 150
AsuHPI GGTGA 1 cut(s) 168
BccI CCATC 1 cut(s) 113
BceAI ACGGC 1 cut(s) 12
BciT130I CCWGG 2 cut(s) 36, 181
BfaI CTAG 1 cut(s) 83
Bme1390I CCNGG 2 cut(s) 36, 181
BmrFI CCNGG 2 cut(s) 36, 181
BsaJI CCNNGG 1 cut(s) 179
BseBI CCWGG 2 cut(s) 36, 181
BseDI CCNNGG 1 cut(s) 179
BseGI GGATG 1 cut(s) 124
BsgI GTGCAG 1 cut(s) 34
BslFI GGGAC 1 cut(s) 70
BsmFI GGGAC 1 cut(s) 70
Bsp143I GATC 1 cut(s) 88
BspPI GGATC 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 179
BssMI GATC 1 cut(s) 88
Bst2UI CCWGG 2 cut(s) 36, 181
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 1 cut(s) 91
BstMBI GATC 1 cut(s) 88
BstNI CCWGG 2 cut(s) 36, 181
BstSCI CCNGG 2 cut(s) 34, 179
BtsCI GGATG 1 cut(s) 124
CspCI CAANNNNNGTGG 2 cut(s) 80, 115
CviJI RGCY 2 cut(s) 34, 82
CviKI_1 RGCY 2 cut(s) 34, 82
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
EcoRI GAATTC 1 cut(s) 4
EcoRII CCWGG 2 cut(s) 34, 179
FaiI YATR 2 cut(s) 25, 170
FaqI GGGAC 1 cut(s) 70
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 83
HphI GGTGA 1 cut(s) 168
Hpy166II GTNNAC 1 cut(s) 186
Hpy8I GTNNAC 1 cut(s) 186
HpyCH4V TGCA 2 cut(s) 15, 155
Kzo9I GATC 1 cut(s) 88
LpnPI CCDG 5 cut(s) 21, 48, 166, 183, 193
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 193
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 1 cut(s) 81
MluCI AATT 2 cut(s) 4, 94
MmeI TCCRAC 1 cut(s) 46
MnlI CCTC 1 cut(s) 79
MseI TTAA 1 cut(s) 141
MspR9I CCNGG 2 cut(s) 36, 181
MvaI CCWGG 2 cut(s) 36, 181
NdeII GATC 1 cut(s) 88
Psp6I CCWGG 2 cut(s) 34, 179
PspGI CCWGG 2 cut(s) 34, 179
SaqAI TTAA 1 cut(s) 141
Sau3AI GATC 1 cut(s) 88
ScrFI CCNGG 2 cut(s) 36, 181
SetI ASST 2 cut(s) 185, 214
Sse9I AATT 2 cut(s) 4, 94
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 2 cut(s) 34, 179
TasI AATT 2 cut(s) 4, 94
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 2 cut(s) 4, 94
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.