Rmu_sc0000897.1_g000004

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000897.1
Physical Location & Seq
Forward (+)
4272 .. 6762
2491 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000897.1_g000004.1.cds

Sequence Viewer

Length: 1014 bp
atggataacggaatcaagaacggtgctgaagccataacagtctcggctctcaattgtattgatctctcaaccacagattctcaccaatccgtctctctactcaaacaggcctgtttggattgcggtttcttctacgtggtaaatcatggaataaccgagcaattcatggacgaggtgttttcacagagcaggaggatgttcagtttaccgttgagtgaaaaaatgaagcttttgaggaacaagaagcacaggggatatacccctcttcttgatgagcatctggaccatgaaaaccaagttcatgtaggagattacaaggaggggtattacataggagttgaggtagctgaagacgacccaaaagcggaaaagccattttatggtcctaatgtttggcctgcaccagatatcttgcctgggtggagggagaccatggaagaatttcatagacaagccttagaggtggctaaagcagttgctaggcttatagcccttgctcttgatctagatgttcatttctttgataagcaagaaatgctcggtgaggctattgcgacgttgcgcttactacactatgaaggaaaaatatctgatccatcaaacggaattttcggagctggagcacattctgacttcggtctcattaccctcttggcaactgatgatgtcttaggtctccaaatatgcaaggataaggatgccaaacctcagttgtgggaatacgtagcaccggttaaaggagcatttatagtgaatcttggtgacatgctggaacgctggagtaactgtattttcaagtccacattgcatagagttttagggaacggtcgagagagatactctattgcatactttatagaacctagtcatgattgtcttgtcgagtgcttgccttcctgcaagtcagaaaataaccctcccaagtttcctccaatcttgtgtcaaacttacctgagccagcgctatagtgatactcatgctgatctgactacctacggagaaaataaaaaataa

Protein Analysis

337

Amino Acids

38.0

Weight (kDa)

5.38

Isoelectric Point (pI)

38.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 380
AciI CCGC 2 cut(s) 123, 365
AclWI GGATC 1 cut(s) 587
AcsI RAATTY 2 cut(s) 440, 606
AcuI CTGAAG 2 cut(s) 48, 369
AfeI AGCGCT 1 cut(s) 962
AfiI CCNNNNNNNGG 4 cut(s) 364, 380, 602, 737
AgeI ACCGGT 1 cut(s) 730
AgsI TTSAA 1 cut(s) 796
AjnI CCWGG 1 cut(s) 415
AluBI AGCT 3 cut(s) 229, 347, 617
AluI AGCT 3 cut(s) 229, 347, 617
Alw21I GWGCWC 1 cut(s) 625
Alw26I GTCTC 5 cut(s) 46, 97, 422, 644, 680
AlwI GGATC 1 cut(s) 587
Aor51HI AGCGCT 1 cut(s) 962
AoxI GGCC 2 cut(s) 108, 395
ApoI RAATTY 2 cut(s) 440, 606
AsiGI ACCGGT 1 cut(s) 730
Asp700I GAANNNNTTC 1 cut(s) 441
AspLEI GCGC 2 cut(s) 564, 963
AspS9I GGNCC 2 cut(s) 283, 383
AsuHPI GGTGA 3 cut(s) 74, 554, 773
AvaII GGWCC 2 cut(s) 283, 383
BbsI GAAGAC 1 cut(s) 357
Bbv12I GWGCWC 1 cut(s) 625
BccI CCATC 1 cut(s) 604
BciT130I CCWGG 1 cut(s) 417
BcoDI GTCTC 5 cut(s) 46, 97, 422, 644, 680
BfaI CTAG 3 cut(s) 480, 506, 864
BfmI CTRYAG 1 cut(s) 964
BfoI RGCGCY 1 cut(s) 964
Bme1390I CCNGG 1 cut(s) 417
Bme18I GGWCC 2 cut(s) 283, 383
BmgT120I GGNCC 2 cut(s) 283, 383
BmrFI CCNGG 1 cut(s) 417
BmsI GCATC 2 cut(s) 286, 688
BoxI GACNNNNGTC 1 cut(s) 636
BpiI GAAGAC 1 cut(s) 357
BplI GAGNNNNNCTC 2 cut(s) 824, 856
BpmI CTGGAG 2 cut(s) 639, 799
Bpu10I CCTNAGC 1 cut(s) 953
BsaAI YACGTR 2 cut(s) 136, 724
BsaBI GATNNNNATC 1 cut(s) 276
BsaI GGTCTC 3 cut(s) 422, 644, 680
BsaJI CCNNGG 2 cut(s) 416, 432
BsaWI WCCGGW 1 cut(s) 730
BsaXI ACNNNNNCTCC 4 cut(s) 327, 357, 772, 802
Bsc4I CCNNNNNNNGG 4 cut(s) 364, 380, 602, 737
Bse118I RCCGGY 1 cut(s) 730
Bse3DI GCAATG 1 cut(s) 803
Bse8I GATNNNNATC 1 cut(s) 276
BseBI CCWGG 1 cut(s) 417
BseDI CCNNGG 2 cut(s) 416, 432
BseGI GGATG 2 cut(s) 201, 703
BseJI GATNNNNATC 1 cut(s) 276
BseLI CCNNNNNNNGG 4 cut(s) 364, 380, 602, 737
BseMI GCAATG 1 cut(s) 803
BseMII CTCAG 2 cut(s) 722, 944
BsgI GTGCAG 1 cut(s) 384
Bsh1285I CGRYCG 1 cut(s) 829
BshFI GGCC 2 cut(s) 110, 397
BshTI ACCGGT 1 cut(s) 730
BsiEI CGRYCG 1 cut(s) 829
BsiHKAI GWGCWC 1 cut(s) 625
BsiSI CCGG 1 cut(s) 731
BslI CCNNNNNNNGG 4 cut(s) 364, 380, 602, 737
BsmAI GTCTC 5 cut(s) 46, 97, 422, 644, 680
BsmBI CGTCTC 1 cut(s) 97
BsnI GGCC 2 cut(s) 110, 397
Bso31I GGTCTC 3 cut(s) 422, 644, 680
Bsp1286I GDGCHC 1 cut(s) 625
Bsp143I GATC 4 cut(s) 61, 502, 592, 982
Bsp19I CCATGG 1 cut(s) 432
BspACI CCGC 2 cut(s) 123, 365
BspANI GGCC 2 cut(s) 110, 397
BspCNI CTCAG 2 cut(s) 721, 945
BspHI TCATGA 1 cut(s) 868
BspPI GGATC 1 cut(s) 587
BspTNI GGTCTC 3 cut(s) 422, 644, 680
BsrDI GCAATG 1 cut(s) 803
BsrFI RCCGGY 1 cut(s) 730
BssAI RCCGGY 1 cut(s) 730
BssECI CCNNGG 2 cut(s) 416, 432
BssMI GATC 4 cut(s) 61, 502, 592, 982
BssT1I CCWWGG 1 cut(s) 432
Bst2UI CCWGG 1 cut(s) 417
Bst4CI ACNGT 5 cut(s) 23, 40, 210, 788, 827
Bst6I CTCTTC 1 cut(s) 270
BstAPI GCANNNNNTGC 1 cut(s) 535
BstBAI YACGTR 2 cut(s) 136, 724
BstC8I GCNNGC 3 cut(s) 399, 890, 959
BstDEI CTNAG 4 cut(s) 457, 670, 708, 953
BstDSI CCRYGG 1 cut(s) 432
BstF5I GGATG 2 cut(s) 201, 703
BstH2I RGCGCY 1 cut(s) 964
BstHHI GCGC 2 cut(s) 564, 963
BstKTI GATC 4 cut(s) 64, 505, 595, 985
BstMAI GTCTC 5 cut(s) 46, 97, 422, 644, 680
BstMBI GATC 4 cut(s) 61, 502, 592, 982
BstMCI CGRYCG 1 cut(s) 829
BstMWI GCNNNNNNNGC 1 cut(s) 535
BstNI CCWGG 1 cut(s) 417
BstNSI RCATGY 1 cut(s) 769
BstPAI GACNNNNGTC 1 cut(s) 636
BstSCI CCNGG 1 cut(s) 415
BstSFI CTRYAG 1 cut(s) 964
BstSNI TACGTA 1 cut(s) 724
BstV2I GAAGAC 1 cut(s) 357
BsuRI GGCC 2 cut(s) 110, 397
BtgI CCRYGG 1 cut(s) 432
BtsCI GGATG 2 cut(s) 201, 703
Cac8I GCNNGC 3 cut(s) 399, 890, 959
CciI TCATGA 1 cut(s) 868
CfoI GCGC 2 cut(s) 564, 963
Cfr10I RCCGGY 1 cut(s) 730
Cfr13I GGNCC 2 cut(s) 283, 383
CspAI ACCGGT 1 cut(s) 730
CviAII CATG 8 cut(s) 146, 166, 287, 302, 433, 766, 869, 977
DdeI CTNAG 4 cut(s) 457, 670, 708, 953
DpnI GATC 4 cut(s) 63, 504, 594, 984
DpnII GATC 4 cut(s) 61, 502, 592, 982
Eam1104I CTCTTC 1 cut(s) 270
EarI CTCTTC 1 cut(s) 270
Eco105I TACGTA 1 cut(s) 724
Eco130I CCWWGG 1 cut(s) 432
Eco147I AGGCCT 1 cut(s) 110
Eco31I GGTCTC 3 cut(s) 422, 644, 680
Eco32I GATATC 1 cut(s) 409
Eco47I GGWCC 2 cut(s) 283, 383
Eco47III AGCGCT 1 cut(s) 962
Eco57I CTGAAG 2 cut(s) 48, 369
EcoRII CCWGG 1 cut(s) 415
EcoRV GATATC 1 cut(s) 409
EcoT14I CCWWGG 1 cut(s) 432
ErhI CCWWGG 1 cut(s) 432
Esp3I CGTCTC 1 cut(s) 97
FaeI CATG 8 cut(s) 149, 169, 290, 305, 436, 769, 872, 980
FatI CATG 8 cut(s) 145, 165, 286, 301, 432, 765, 868, 976
FokI GGATG 2 cut(s) 208, 710
FspBI CTAG 3 cut(s) 480, 506, 864
GlaI GCGC 2 cut(s) 563, 962
GsuI CTGGAG 2 cut(s) 639, 799
HaeII RGCGCY 1 cut(s) 964
HaeIII GGCC 2 cut(s) 110, 397
HapII CCGG 1 cut(s) 731
HhaI GCGC 2 cut(s) 564, 963
Hin1II CATG 8 cut(s) 149, 169, 290, 305, 436, 769, 872, 980
Hin6I GCGC 2 cut(s) 562, 961
HinP1I GCGC 2 cut(s) 562, 961
HindIII AAGCTT 1 cut(s) 227
HinfI GANTC 3 cut(s) 12, 77, 754
HpaII CCGG 1 cut(s) 731
HphI GGTGA 3 cut(s) 74, 554, 773
Hpy166II GTNNAC 2 cut(s) 206, 801
Hpy188I TCNGA 5 cut(s) 592, 614, 631, 907, 987
Hpy188III TCNNGA 7 cut(s) 16, 269, 281, 500, 506, 830, 869
Hpy8I GTNNAC 2 cut(s) 206, 801
Hpy99I CGWCG 1 cut(s) 559
HpyAV CCTTC 2 cut(s) 572, 903
HpyCH4III ACNGT 5 cut(s) 23, 40, 210, 788, 827
HpyCH4IV ACGT 3 cut(s) 135, 557, 723
HpyCH4V TGCA 5 cut(s) 401, 687, 808, 848, 900
HpyF10VI GCNNNNNNNGC 1 cut(s) 535
HpyF3I CTNAG 4 cut(s) 457, 670, 708, 953
HpySE526I ACGT 3 cut(s) 135, 557, 723
Hsp92II CATG 8 cut(s) 149, 169, 290, 305, 436, 769, 872, 980
HspAI GCGC 2 cut(s) 562, 961
Kzo9I GATC 4 cut(s) 61, 502, 592, 982
LmnI GCTCC 3 cut(s) 614, 620, 740
LweI GCATC 2 cut(s) 286, 688
MaeI CTAG 3 cut(s) 480, 506, 864
MaeII ACGT 3 cut(s) 135, 557, 723
MaeIII GTNAC 2 cut(s) 761, 782
MalI GATC 4 cut(s) 63, 504, 594, 984
MboI GATC 4 cut(s) 61, 502, 592, 982
MboII GAAGA 4 cut(s) 121, 257, 362, 449
MfeI CAATTG 1 cut(s) 52
MhlI GDGCHC 1 cut(s) 625
MluCI AATT 4 cut(s) 52, 161, 440, 606
MroXI GAANNNNTTC 1 cut(s) 441
MseI TTAA 1 cut(s) 735
MspI CCGG 1 cut(s) 731
MspR9I CCNGG 1 cut(s) 417
MunI CAATTG 1 cut(s) 52
MvaI CCWGG 1 cut(s) 417
MwoI GCNNNNNNNGC 1 cut(s) 535
NcoI CCATGG 1 cut(s) 432
NdeII GATC 4 cut(s) 61, 502, 592, 982
NlaIII CATG 8 cut(s) 149, 169, 290, 305, 436, 769, 872, 980
NmeAIII GCCGAG 1 cut(s) 23
NmuCI GTSAC 1 cut(s) 761
NspI RCATGY 1 cut(s) 769
PagI TCATGA 1 cut(s) 868
PceI AGGCCT 1 cut(s) 110
PdmI GAANNNNTTC 1 cut(s) 441
PfeI GAWTC 3 cut(s) 12, 77, 754
PflMI CCANNNNNTGG 1 cut(s) 380
PinAI ACCGGT 1 cut(s) 730
Ppu21I YACGTR 2 cut(s) 136, 724
PshAI GACNNNNGTC 1 cut(s) 636
Psp6I CCWGG 1 cut(s) 415
PspGI CCWGG 1 cut(s) 415
PspPI GGNCC 2 cut(s) 283, 383
SaqAI TTAA 1 cut(s) 735
Sau3AI GATC 4 cut(s) 61, 502, 592, 982
Sau96I GGNCC 2 cut(s) 283, 383
ScrFI CCNGG 1 cut(s) 417
SduI GDGCHC 1 cut(s) 625
SfaNI GCATC 2 cut(s) 286, 688
SfcI CTRYAG 1 cut(s) 964
SinI GGWCC 2 cut(s) 283, 383
SnaBI TACGTA 1 cut(s) 724
Sse9I AATT 4 cut(s) 52, 161, 440, 606
SseBI AGGCCT 1 cut(s) 110
SsiI CCGC 2 cut(s) 123, 365
SspMI CTAG 3 cut(s) 480, 506, 864
StuI AGGCCT 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 415
StyI CCWWGG 1 cut(s) 432
TaaI ACNGT 5 cut(s) 23, 40, 210, 788, 827
TaiI ACGT 3 cut(s) 138, 560, 726
TaqI TCGA 2 cut(s) 829, 882
TaqII GACCGA 1 cut(s) 626
TasI AATT 4 cut(s) 52, 161, 440, 606
TfiI GAWTC 3 cut(s) 12, 77, 754
Tru1I TTAA 1 cut(s) 735
Tru9I TTAA 1 cut(s) 735
TseFI GTSAC 1 cut(s) 761
Tsp45I GTSAC 1 cut(s) 761
TspDTI ATGAA 7 cut(s) 154, 239, 290, 303, 434, 503, 591
TspGWI ACGGA 4 cut(s) 24, 79, 618, 1011
Van91I CCANNNNNTGG 1 cut(s) 380
VpaK11BI GGWCC 2 cut(s) 283, 383
XapI RAATTY 2 cut(s) 440, 606
XbaI TCTAGA 1 cut(s) 505
XceI RCATGY 1 cut(s) 769
XmnI GAANNNNTTC 1 cut(s) 441
XspI CTAG 3 cut(s) 480, 506, 864
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.