Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000998.1

Orthogroup ID

OG0003993

Physical Location & Seq

Genomic Coordinates Reverse (-)

23599 .. 24788

Gene Structure 1190 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 945 bp

atgatgattgatatgcagggaagaggatcagaagcacaattagttgaaaatttttacagctctagttgtccaaacgttgaatccatagtgaagcaggcagtttctacaaaattcagccaaaccttcacgacaattccggctactctacgactcttttttcatgactgctttgtggagggatgcgatgcctcggtcatgatatcatcaccaaatggggatgcagagaaggactcgtcggataatctttcattggctggagatgggtttgacaccgtcatcaaggctaagcaagccgtcgaagcgcaatgccctgccgtcgtttcttgtgctgacattctggctcttgctacccgcgacgttgtagttcttggtggaggtccggacttcaacgtagaattgggacgtcgagatggactagtctccaaagcctcacgggtcgccggaaacttgccggaaccatcatttgatcttaaacaactcaacactatgtttgccaaacacaacctaacccaaaccgacgtcattgcattatccggagcacatactctagggttttcacactgcaaccgcttcgccaaccgcttgtattcattctcgtcatcctccgtcgttgacccgtcgttggatcccgactacgccaagcagctgatgtcagcctgccctcaggatgtggaccccagcatagccatcgacatggaccctcaaaccccacgaacgtttgacaacgcgtattaccagaacttggttgccggaaagggcttgtttacctcggacgaggttcttttctcggactcggcgtctcagtctactgtcgtggactttgctaacagccccggtgagtttagtggagccttcatcactgccatgaggaagctcggcagggtcgacgttaagactggtggtcaaggggagattaggacggattgcaccgccttcaattcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00940 ko01100 ko01110 map00940 map01100 map01110

Pfam Domains

Protein Families

peroxidase

Protein Analysis

314

Amino Acids

33.6

Weight (kDa)

4.62

Isoelectric Point (pI)

40.18

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
peroxidase	PF00141	30 - 277	1e-81	Peroxidase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003993)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G14130 AT5G14130
fragaria_vesca	FvH4_6g53650 FvH4_6g53680 FvH4_6g53690
malus_domestica	MD09G1009900.v1.1 MD09G1010000.v1.1
prunus_persica	Prupe.3G307200_v2.0.a1
pyrus_communis	pycom111g00790 pycom111g00800
rosa_chinensis	RchiOBHm_Chr2g0175751 RchiOBHm_Chr2g0175761
rosa_laevigata	RLG00000022354 RLG00000022356
rosa_multiflora	Rmu_co8488167.1_g000001 Rmu_sc0000998.1_g000007 Rmu_sc0000998.1_g000008 Rmu_sc0016745.1_g000002 Rmu_sc0016745.1_g000003
rosa_roxburghii	Rroxscaffold_2G00077040 Rroxscaffold_2G00077050
rosa_rugosa	Rorug02G0587400 Rorug02G0587500
rosa_samantha	Rh2AG666400 Rh2AG666500 Rh2BG677800 Rh2BG677900 Rh2CG640900 Rh2CG641000 Rh2DG691600 Rh2DG691700
rosa_wichuraiana	Rw2G054640 Rw2G054650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	2 cut(s)	406, 522
AccB7I	CCANNNNNTGG	1 cut(s)	742
AccI	GTMKAC	2 cut(s)	806, 885
AccII	CGCG	2 cut(s)	354, 728
AccIII	TCCGGA	2 cut(s)	379, 533
AciI	CCGC	4 cut(s)	352, 568, 580, 930
AclI	AACGTT	2 cut(s)	75, 716
AclWI	GGATC	3 cut(s)	34, 620, 633
AcsI	RAATTY	2 cut(s)	49, 110
AcyI	GRCGYC	3 cut(s)	403, 519, 797
AfiI	CCNNNNNNNGG	2 cut(s)	622, 742
AflIII	ACRYGT	1 cut(s)	726
AgsI	TTSAA	4 cut(s)	47, 80, 388, 937
AhdI	GACNNNNNGTC	2 cut(s)	796, 900
AhlI	ACTAGT	1 cut(s)	415
AluBI	AGCT	3 cut(s)	60, 646, 874
AluI	AGCT	3 cut(s)	60, 646, 874
Alw21I	GWGCWC	1 cut(s)	541
Alw26I	GTCTC	2 cut(s)	424, 804
AlwI	GGATC	3 cut(s)	34, 620, 633
Aor13HI	TCCGGA	2 cut(s)	379, 533
ApeKI	GCWGC	1 cut(s)	643
ApoI	RAATTY	2 cut(s)	49, 110
AspLEI	GCGC	1 cut(s)	304
AspS9I	GGNCC	3 cut(s)	377, 673, 697
AsuC2I	CCSGG	1 cut(s)	834
AsuHPI	GGTGA	2 cut(s)	198, 848
AvaII	GGWCC	3 cut(s)	377, 673, 697
AxyI	CCTNAGG	1 cut(s)	663
BamHI	GGATCC	1 cut(s)	625
Bbv12I	GWGCWC	1 cut(s)	541
BbvI	GCAGC	1 cut(s)	655
BccI	CCATC	4 cut(s)	254, 404, 466, 695
BceAI	ACGGC	2 cut(s)	278, 299
BcgI	CGANNNNNNTGC	6 cut(s)	506, 540, 553, 587, 670, 704
BcnI	CCSGG	1 cut(s)	834
BcoDI	GTCTC	2 cut(s)	424, 804
BcuI	ACTAGT	1 cut(s)	415
BfaI	CTAG	3 cut(s)	63, 416, 548
BisI	GCNGC	1 cut(s)	644
BlpI	GCTNAGC	1 cut(s)	285
BlsI	GCNGC	1 cut(s)	645
Bme1390I	CCNGG	1 cut(s)	834
Bme18I	GGWCC	3 cut(s)	377, 673, 697
BmeRI	GACNNNNNGTC	2 cut(s)	796, 900
BmgT120I	GGNCC	3 cut(s)	377, 673, 697
BmiI	GGNNCC	5 cut(s)	456, 627, 675, 699, 850
BmrFI	CCNGG	1 cut(s)	834
BmsI	GCATC	3 cut(s)	170, 175, 208
BplI	GAGNNNNNCTC	2 cut(s)	215, 247
BpmI	CTGGAG	1 cut(s)	276
Bpu1102I	GCTNAGC	1 cut(s)	285
BpuMI	CCSGG	1 cut(s)	834
BsaHI	GRCGYC	3 cut(s)	403, 519, 797
BsaJI	CCNNGG	3 cut(s)	189, 768, 832
BsaWI	WCCGGW	2 cut(s)	379, 533
Bsc4I	CCNNNNNNNGG	2 cut(s)	622, 742
Bse1I	ACTGG	1 cut(s)	901
Bse21I	CCTNAGG	1 cut(s)	663
Bse3DI	GCAATG	2 cut(s)	311, 522
BseAI	TCCGGA	2 cut(s)	379, 533
BseDI	CCNNGG	3 cut(s)	189, 768, 832
BseGI	GGATG	4 cut(s)	185, 223, 599, 673
BseLI	CCNNNNNNNGG	2 cut(s)	622, 742
BseMI	GCAATG	2 cut(s)	311, 522
BseMII	CTCAG	2 cut(s)	677, 815
BseNI	ACTGG	1 cut(s)	901
BseXI	GCAGC	1 cut(s)	655
BseYI	CCCAGC	1 cut(s)	677
Bsh1236I	CGCG	2 cut(s)	354, 728
BsiHKAI	GWGCWC	1 cut(s)	541
BsiSI	CCGG	7 cut(s)	137, 380, 441, 452, 534, 750, 834
BslFI	GGGAC	1 cut(s)	414
BslI	CCNNNNNNNGG	2 cut(s)	622, 742
BsmAI	GTCTC	2 cut(s)	424, 804
BsmBI	CGTCTC	1 cut(s)	804
BsmFI	GGGAC	1 cut(s)	414
Bsp1286I	GDGCHC	1 cut(s)	541
Bsp13I	TCCGGA	2 cut(s)	379, 533
Bsp143I	GATC	3 cut(s)	26, 466, 625
Bsp1720I	GCTNAGC	1 cut(s)	285
BspACI	CCGC	4 cut(s)	352, 568, 580, 930
BspCNI	CTCAG	2 cut(s)	676, 814
BspEI	TCCGGA	2 cut(s)	379, 533
BspFNI	CGCG	2 cut(s)	354, 728
BspHI	TCATGA	3 cut(s)	160, 195, 941
BspLI	GGNNCC	5 cut(s)	456, 627, 675, 699, 850
BspPI	GGATC	3 cut(s)	34, 620, 633
BsrDI	GCAATG	2 cut(s)	311, 522
BsrI	ACTGG	1 cut(s)	901
BssECI	CCNNGG	3 cut(s)	189, 768, 832
BssMI	GATC	3 cut(s)	26, 466, 625
BssNI	GRCGYC	3 cut(s)	403, 519, 797
Bst4CI	ACNGT	2 cut(s)	274, 811
Bst6I	CTCTTC	1 cut(s)	16
BstACI	GRCGYC	3 cut(s)	403, 519, 797
BstC8I	GCNNGC	3 cut(s)	96, 291, 658
BstDEI	CTNAG	3 cut(s)	285, 663, 801
BstF5I	GGATG	4 cut(s)	185, 223, 599, 673
BstFNI	CGCG	2 cut(s)	354, 728
BstHHI	GCGC	1 cut(s)	304
BstKTI	GATC	3 cut(s)	29, 469, 628
BstMAI	GTCTC	2 cut(s)	424, 804
BstMBI	GATC	3 cut(s)	26, 466, 625
BstMWI	GCNNNNNNNGC	2 cut(s)	290, 299
BstSCI	CCNGG	1 cut(s)	832
BstUI	CGCG	2 cut(s)	354, 728
BstV1I	GCAGC	1 cut(s)	655
BstX2I	RGATCY	1 cut(s)	625
BstXI	CCANNNNNNTGG	1 cut(s)	694
BstYI	RGATCY	1 cut(s)	625
Bsu36I	CCTNAGG	1 cut(s)	663
BtgZI	GCGATG	1 cut(s)	198
BtsCI	GGATG	4 cut(s)	185, 223, 599, 673
BtsI	GCAGTG	2 cut(s)	559, 858
BtsIMutI	CAGTG	2 cut(s)	559, 858
Cac8I	GCNNGC	3 cut(s)	96, 291, 658
CciI	TCATGA	3 cut(s)	160, 195, 941
CfoI	GCGC	1 cut(s)	304
Cfr13I	GGNCC	3 cut(s)	377, 673, 697
CseI	GACGC	1 cut(s)	786
CviAII	CATG	5 cut(s)	161, 196, 694, 865, 942
DdeI	CTNAG	3 cut(s)	285, 663, 801
DpnI	GATC	3 cut(s)	28, 468, 627
DpnII	GATC	3 cut(s)	26, 466, 625
DriI	GACNNNNNGTC	2 cut(s)	796, 900
Eam1104I	CTCTTC	1 cut(s)	16
Eam1105I	GACNNNNNGTC	2 cut(s)	796, 900
EarI	CTCTTC	1 cut(s)	16
Eco32I	GATATC	1 cut(s)	201
Eco47I	GGWCC	3 cut(s)	377, 673, 697
Eco81I	CCTNAGG	1 cut(s)	663
EcoRV	GATATC	1 cut(s)	201
Esp3I	CGTCTC	1 cut(s)	804
FaeI	CATG	5 cut(s)	164, 199, 697, 868, 945
FaqI	GGGAC	1 cut(s)	414
FatI	CATG	5 cut(s)	160, 195, 693, 864, 941
FauI	CCCGC	1 cut(s)	359
FblI	GTMKAC	2 cut(s)	806, 885
Fnu4HI	GCNGC	1 cut(s)	644
FokI	GGATG	4 cut(s)	192, 230, 586, 680
Fsp4HI	GCNGC	1 cut(s)	644
FspBI	CTAG	3 cut(s)	63, 416, 548
GlaI	GCGC	1 cut(s)	303
GluI	GCNGC	1 cut(s)	644
GsaI	CCCAGC	1 cut(s)	681
GsuI	CTGGAG	1 cut(s)	276
HapII	CCGG	7 cut(s)	137, 380, 441, 452, 534, 750, 834
HgaI	GACGC	1 cut(s)	786
HhaI	GCGC	1 cut(s)	304
Hin1I	GRCGYC	3 cut(s)	403, 519, 797
Hin1II	CATG	5 cut(s)	164, 199, 697, 868, 945
Hin6I	GCGC	1 cut(s)	302
HinP1I	GCGC	1 cut(s)	302
HincII	GTYRAC	2 cut(s)	613, 886
HindII	GTYRAC	2 cut(s)	613, 886
HinfI	GANTC	4 cut(s)	80, 150, 230, 791
HpaII	CCGG	7 cut(s)	137, 380, 441, 452, 534, 750, 834
HphI	GGTGA	2 cut(s)	198, 848
Hpy166II	GTNNAC	6 cut(s)	613, 673, 765, 807, 817, 886
Hpy188I	TCNGA	4 cut(s)	31, 238, 772, 790
Hpy188III	TCNNGA	9 cut(s)	127, 161, 196, 380, 407, 534, 629, 665, 942
Hpy8I	GTNNAC	6 cut(s)	613, 673, 765, 807, 817, 886
Hpy99I	CGWCG	9 cut(s)	238, 299, 320, 359, 408, 521, 611, 622, 890
HpyAV	CCTTC	4 cut(s)	133, 220, 862, 943
HpyCH4III	ACNGT	2 cut(s)	274, 811
HpyCH4IV	ACGT	7 cut(s)	75, 357, 390, 403, 519, 716, 888
HpyCH4V	TGCA	5 cut(s)	16, 221, 527, 564, 927
HpyF10VI	GCNNNNNNNGC	2 cut(s)	290, 299
HpyF3I	CTNAG	3 cut(s)	285, 663, 801
HpySE526I	ACGT	7 cut(s)	75, 357, 390, 403, 519, 716, 888
Hsp92I	GRCGYC	3 cut(s)	403, 519, 797
Hsp92II	CATG	5 cut(s)	164, 199, 697, 868, 945
HspAI	GCGC	1 cut(s)	302
Kpn2I	TCCGGA	2 cut(s)	379, 533
Kzo9I	GATC	3 cut(s)	26, 466, 625
LmnI	GCTCC	2 cut(s)	536, 848
Lsp1109I	GCAGC	1 cut(s)	655
LweI	GCATC	3 cut(s)	170, 175, 208
MaeI	CTAG	3 cut(s)	63, 416, 548
MaeII	ACGT	7 cut(s)	75, 357, 390, 403, 519, 716, 888
MalI	GATC	3 cut(s)	28, 468, 627
MboI	GATC	3 cut(s)	26, 466, 625
MboII	GAAGA	1 cut(s)	33
MflI	RGATCY	1 cut(s)	625
MhlI	GDGCHC	1 cut(s)	541
MluCI	AATT	6 cut(s)	38, 49, 110, 132, 395, 937
MluI	ACGCGT	1 cut(s)	726
MlyI	GAGTC	3 cut(s)	144, 224, 785
MmeI	TCCRAC	2 cut(s)	216, 603
MroI	TCCGGA	2 cut(s)	379, 533
MseI	TTAA	2 cut(s)	471, 891
MslI	CAYNNNNRTG	2 cut(s)	692, 863
MspA1I	CMGCKG	1 cut(s)	646
MspI	CCGG	7 cut(s)	137, 380, 441, 452, 534, 750, 834
MspR9I	CCNGG	1 cut(s)	834
MvnI	CGCG	2 cut(s)	354, 728
MwoI	GCNNNNNNNGC	2 cut(s)	290, 299
NciI	CCSGG	1 cut(s)	834
NdeII	GATC	3 cut(s)	26, 466, 625
NlaIII	CATG	5 cut(s)	164, 199, 697, 868, 945
NlaIV	GGNNCC	5 cut(s)	456, 627, 675, 699, 850
NmeAIII	GCCGAG	2 cut(s)	773, 855
PagI	TCATGA	3 cut(s)	160, 195, 941
PcsI	WCGNNNNNNNCGW	2 cut(s)	794, 882
PfeI	GAWTC	1 cut(s)	80
PflFI	GACNNNGTC	1 cut(s)	272
PflMI	CCANNNNNTGG	1 cut(s)	742
PkrI	GCNGC	1 cut(s)	645
PleI	GAGTC	3 cut(s)	144, 224, 785
PpsI	GAGTC	3 cut(s)	144, 224, 785
Psp1406I	AACGTT	2 cut(s)	75, 716
PspFI	CCCAGC	1 cut(s)	677
PspN4I	GGNNCC	5 cut(s)	456, 627, 675, 699, 850
PspPI	GGNCC	3 cut(s)	377, 673, 697
PsuI	RGATCY	1 cut(s)	625
PsyI	GACNNNGTC	1 cut(s)	272
PvuII	CAGCTG	1 cut(s)	646
RseI	CAYNNNNRTG	2 cut(s)	692, 863
SalI	GTCGAC	1 cut(s)	884
SaqAI	TTAA	2 cut(s)	471, 891
SatI	GCNGC	1 cut(s)	644
Sau3AI	GATC	3 cut(s)	26, 466, 625
Sau96I	GGNCC	3 cut(s)	377, 673, 697
SchI	GAGTC	3 cut(s)	144, 224, 785
ScrFI	CCNGG	1 cut(s)	834
SduI	GDGCHC	1 cut(s)	541
SfaNI	GCATC	3 cut(s)	170, 175, 208
SinI	GGWCC	3 cut(s)	377, 673, 697
SmiMI	CAYNNNNRTG	2 cut(s)	692, 863
SpeI	ACTAGT	1 cut(s)	415
Sse9I	AATT	6 cut(s)	38, 49, 110, 132, 395, 937
SsiI	CCGC	4 cut(s)	352, 568, 580, 930
SspMI	CTAG	3 cut(s)	63, 416, 548
StyD4I	CCNGG	1 cut(s)	832
TaaI	ACNGT	2 cut(s)	274, 811
TaiI	ACGT	7 cut(s)	78, 360, 393, 406, 522, 719, 891
TaqI	TCGA	4 cut(s)	297, 406, 690, 885
TaqII	GACCGA	1 cut(s)	181
TasI	AATT	6 cut(s)	38, 49, 110, 132, 395, 937
TfiI	GAWTC	1 cut(s)	80
Tru1I	TTAA	2 cut(s)	471, 891
Tru9I	TTAA	2 cut(s)	471, 891
TscAI	CASTG	2 cut(s)	566, 865
TseI	GCWGC	1 cut(s)	643
TspDTI	ATGAA	5 cut(s)	149, 237, 579, 844, 930
TspGWI	ACGGA	2 cut(s)	595, 935
TspRI	CASTG	2 cut(s)	566, 865
Tth111I	GACNNNGTC	1 cut(s)	272
Van91I	CCANNNNNTGG	1 cut(s)	742
VpaK11BI	GGWCC	3 cut(s)	377, 673, 697
XapI	RAATTY	2 cut(s)	49, 110
XmiI	GTMKAC	2 cut(s)	806, 885
XspI	CTAG	3 cut(s)	63, 416, 548
ZraI	GACGTC	2 cut(s)	404, 520

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.