Rmu_sc0001042.1_g000002

CW-type Zinc Finger

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001042.1
Physical Location & Seq
Reverse (-)
15827 .. 23118
7292 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001042.1_g000002.1.cds

Sequence Viewer

Length: 4725 bp
atgatttctgtggggagtagggatgcgaggaaggggctagggttagggttcggagctgggagagagatggacgattccgagcttgaagaaggcgaggcgtgttcttctcaaatcaatgaatacgatcccaatatcgaccccgacgttgctctcgcctacatcgatgataaaattcaggatgttttggggcactttcagaaagattttgaaggtggggtggtgtctgcagagaatctaggggcaaagtttggtgggtatggctcatttttacctagctatcagcggtctccagtgtggtctcatccgaggactccagcaaaaagtcagaattatggcttacccaaatctcccaacagtttaaaacttgagggtggccatcgtaacaattctagttgttatgctgtatctcagtctgttggacttggaactgcttctgccagttccatttcactcgttgcaccaaaggcaccatcagcaaacattccagtcaaacaagatgtgagtgtttcatataatcaagctgaccagtatcctcctgaacaggaatccgcaacaaagagacctattaaattatcagaccagaaaactctcaaggtacggcttagggtgggctcagataacttgtcgacacgaaaaaatgatatctacagtgggcttggccttgacggtacaccatcttcctcattagatgattcttcagatagtgaaggaatatctcatggacctcaagatgccccatttgaatctcccactagtattctccagattatgacatcctgtccggtgtatgagggtatgcttttgtcacctcttcctgaggatctaatttatttaactgaaaaggataaggttgcaaaagaagtcagatctcttccaagggatgatttggaaagatctgggttcctagtgaatggagcaaataccagggagggtggtggaaaagtgtctggggcaaggaaaactaaatcagttgaaagaaatgatttttcagcagaatcaaagagtgggatcaataaggatggaattgggcttctagcaaacaaggaccaagatgttgatacatttgcttgtgaggagcttgtttctaaaaccttgaagctcccacttctatccaattcatactcttctgtcaatgatgtgaaaaagagtaaagaagcagataagaatgctggaagggataaaggcttcccttgtcaaccagaagatgagcctatggagccaacattcaatcaagagcaaaactgggttgaaaagcgaaaagccagtttggctggaaagattcagggagacagaaaagtaagttctaacaataatgtttcggtacatttaaagaaagatggccatcacaaaggagagagaggtaatgaatcagtaaaagctgactcaaatgtatctaaagggaggaaatctttaagtactgaagttgtggaccactcaaagcaaagggtcagtcagaagggtatagcccatgaggtagatgatatgagattactttctgggaaggagcagcccttacttggcgaaaaatggaaatcaaaagaaattccaaggaccctggttacagactttccaaaagaaagctccagggttggttcttcttcagtgcccaaagtgaagagtgctcatgtgaacaagcttacatccaatagtgagtcagaaaacttcagaaaggatcttgataaaagcagggatacatatagggatttctttggggatgaagaagaagagaaccaaactgattcattgcaattgccttctgaagataagcttaaggagcctgatgctgttgcaaaaagcacatctgcagttaacatttcatcaagagagaaaccaaatggcaagatagttgattcacatcctgtaacagcttcaaatatagctcaacgccctggaaacggacccatttctgatgcagctcctgtaacaggggctcctgcattaatggaagactattgggtgcagtgtgacaagtgtctaaaatggcggcttcttccgcatggtacaacccccgacaacttaccagaaaagtggctatgtagcatgcttaattggctgcctgggatgaaccggtgtagtgtaacggaggaggaaacaacagacaagacaaaagctctaattgcacagtaccaagttcctgcccttggcagtcaaaataatcttcccaataatcctggtggctttatggaaggcgttgcacaagctgattttcggcaccctgatcagaacccccaaaattttggtttgcatgccatgcctggcagcgggaagaaaaaaaatggattgaaagaattgtcaaaggcaagtgataaagatggttctattctgctgccaaactctatgaagaagaacatacaggcatcactgaagagtaaaagcttgaatgatgttaaccaatcttcacctctgaatgagcctaatcttcagcagctgagcaattccagtgacttggcagtggagaaacggaagcacaagtacaaagagaagcaaaaagttttaggttcctcttatgatggaggtcctaccaacaatttaaagattaagagcagaagggactttgatccagatacttctagaccacccaagaaaatcaagagcaatggtaggcgtatgactgatgaagaatgggcatcagataaccacggaccagacggcgagattggtcctagctcaagtagtggttttctgactactgaagcaggaaaagatcgaattaaggataggatagaggctgctactcttaccaaagtaaaagatgaagtttgtagagacaacggatccgtagacatgggtaatgtttctagagatagaacaaaaaagagaaaattgaaggaatatcctgaaattcatatgggttcccttccagatcgttccattgtagtgaaggaggagtttagtgagaatgactgtaggaaggaaaagaaggcgagggtatctaaatctgagggaaaagagtccagtgcaagcaaaggcagtggtagaacagacaagaagagcagccattcaaagaagcaacaacgtggaaaagatataagcagcagaccaactcaacggagtcagaatgggatggaatctttgaaaaaagatttgggatctgttcaggtttttgtggctgccacttcaagctcttctaaagtttctggttctcaaaagaccaaatccagctttcaagaaattaaaggttcacctgtagaatctgtttcatcatcacctatgagaatcttaaatcctgataagcatgaattagtacttggggcaaaggatgagtcacaagacactggtcgttttgcattacgtagcccacggagatgctcagatggtgaagatgacggcaggattgatcgatctgggacagcaaggaaggaaaaagtttcctcctgggcttatcgtaggtctgagaaggggaacaaattgcaggagaaggtgaacaaatatggtgaaactgagaacaaatatgtcagtaagaaagatttgccgggaaagtctttgaatgagagtagtaaaagggagagccagtctaattttgggggtcgtgatggccaagatgttagagtagatgctatttacccaaaagacacgatttctactccaaagaagcagccagattctgatagtgaaagatcttcaaagaggatcccttctgaaagaactgatcgagtggatacaggctcaacaagggggaagtcactacccttgccaccctctggaggagctcaaaatgagatgatgactcgttgtccccgaccagtttctggctctcacaaaggtaatggagcagatatattacaagtagatgcctctgaaggtaatgatgtggtcaaggtgcaagtacagaccagaaaggctgatactcagaatggaactcagcatactagttcaagacatcgtgcacagaatgggcacaggggcagggatcttgatgcccctagtccagctagaagggattcttccaccccggcttatatcactgttctaaaagaagctaaagatatgaaacaccttgctgatcgtctcaagaactctcagtcaaatgatagtacggggctttacttccaggcagtcctcaaatttcttcacgctgcatctctcttggaatctcccaacattgacaatgccaagccaaatgagtccatgcaaatttatagaagcactgcggcactatgccagttttgtgctcatgaatatgaaaaatccaaagacatggcttctgctgctttagccttcaaatgcttggaggtggcttatctgaaggtgatatactcatcgcattccaatgcaggcagagatcgacatgagttacaaacagctttacagatgggtcctcctggtgaatctccatcttcctctgcctctgatgttgataacttgaacaatccctcagcagtagacaaggttgccttacccaagggtgttagctcaccccaagttgctggaaaccatgtaattgctgctcgaaatcgtcccaattttgaccgcatgctgaaatttacacaagatgtacatcatgcaatggacgcatcaaagaaatcacgtgttgcttttgcagctgctgatacaaaaatgggagaagctaagtattctgaatgcatctcttccattaaaagggctcttgactttaacttccaagatgtagagggattactacgtttggtacggcttgcaatggaagccattggcaattgccgtcagaagagtccagacggtgggggggatgattctaatctatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1574

Amino Acids

172.0

Weight (kDa)

8.9

Isoelectric Point (pI)

42.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009959)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 466, 2211
AccB7I CCANNNNNTGG 3 cut(s) 3701, 3749, 4700
AccI GTMKAC 3 cut(s) 626, 2781, 4383
AciI CCGC 7 cut(s) 283, 549, 1984, 1994, 2262, 4151, 4471
AcoI YGGCCR 3 cut(s) 373, 1339, 3535
AcsI RAATTY 7 cut(s) 171, 1542, 2233, 2841, 4064, 4134, 4481
AcvI CACGTG 1 cut(s) 4529
AflII CTTAAG 1 cut(s) 1769
AflIII ACRYGT 1 cut(s) 4528
AgeI ACCGGT 1 cut(s) 2067
AhdI GACNNNNNGTC 2 cut(s) 777, 3732
AhlI ACTAGT 2 cut(s) 752, 3869
AjuI GAANNNNNNNTTGG 4 cut(s) 3068, 3100, 3231, 3263
Alw21I GWGCWC 4 cut(s) 1624, 3712, 3889, 4174
Alw26I GTCTC 6 cut(s) 291, 303, 553, 1281, 2760, 4013
Alw44I GTGCAC 1 cut(s) 3885
AlwNI CAGNNNCTG 5 cut(s) 1919, 2428, 3605, 3749, 4547
AoxI GGCC 4 cut(s) 373, 658, 1339, 3535
ApaLI GTGCAC 1 cut(s) 3885
ApoI RAATTY 7 cut(s) 171, 1542, 2233, 2841, 4064, 4134, 4481
ArsI GACNNNNNNTTYG 4 cut(s) 1435, 1467, 3248, 3280
AseI ATTAAT 1 cut(s) 1940
AsiGI ACCGGT 1 cut(s) 2067
Asp700I GAANNNNTTC 2 cut(s) 430, 3940
AspS9I GGNCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
AsuC2I CCSGG 2 cut(s) 3474, 3953
AvaII GGWCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
AxyI CCTNAGG 1 cut(s) 816
BaeGI GKGCMC 4 cut(s) 192, 1608, 3889, 3900
BalI TGGCCA 3 cut(s) 375, 1341, 3537
BamHI GGATCC 2 cut(s) 2774, 3630
BanI GGYRCC 2 cut(s) 466, 2211
BanII GRGCYC 4 cut(s) 614, 1933, 3712, 4606
BarI GAAGNNNNNNTAC 6 cut(s) 661, 693, 2456, 2488, 4238, 4270
BbrPI CACGTG 1 cut(s) 4529
BbsI GAAGAC 1 cut(s) 1953
Bbv12I GWGCWC 4 cut(s) 1624, 3712, 3889, 4174
BbvCI CCTCAGC 1 cut(s) 4375
BceAI ACGGC 5 cut(s) 614, 2665, 3343, 4665, 4667
BciVI GTATCC 3 cut(s) 540, 1684, 3652
BclI TGATCA 1 cut(s) 2218
BcnI CCSGG 2 cut(s) 3474, 3953
BcoDI GTCTC 6 cut(s) 291, 303, 553, 1281, 2760, 4013
BcuI ACTAGT 2 cut(s) 752, 3869
BfmI CTRYAG 5 cut(s) 225, 646, 1803, 2905, 3186
BfrI CTTAAG 1 cut(s) 1769
BfuI GTATCC 3 cut(s) 540, 1684, 3652
BglI GCCNNNNNGGC 1 cut(s) 1268
BglII AGATCT 3 cut(s) 866, 893, 3617
BlpI GCTNAGC 1 cut(s) 2429
BmcAI AGTACT 2 cut(s) 1417, 3246
Bme18I GGWCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
BmeRI GACNNNNNGTC 2 cut(s) 777, 3732
BmgT120I GGNCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
BmrI ACTGGG 1 cut(s) 1252
BmuI ACTGGG 1 cut(s) 1252
BoxI GACNNNNGTC 2 cut(s) 1971, 3276
BpiI GAAGAC 1 cut(s) 1953
BpmI CTGGAG 5 cut(s) 273, 297, 746, 1567, 3723
Bpu10I CCTNAGC 2 cut(s) 602, 4375
Bpu1102I GCTNAGC 1 cut(s) 2429
BpuEI CTTGAG 5 cut(s) 386, 575, 711, 2653, 3995
BpuMI CCSGG 2 cut(s) 3474, 3953
Bsa29I ATCGAT 2 cut(s) 162, 3340
BsaAI YACGTR 2 cut(s) 3293, 4529
BsaBI GATNNNNATC 4 cut(s) 1341, 1854, 4497, 4716
BsaI GGTCTC 3 cut(s) 291, 303, 553
BsaWI WCCGGW 2 cut(s) 781, 2067
BsaXI ACNNNNNCTCC 4 cut(s) 1915, 1945, 3497, 3527
Bse118I RCCGGY 1 cut(s) 2067
Bse21I CCTNAGG 1 cut(s) 816
Bse3DI GCAATG 4 cut(s) 1742, 2602, 4512, 4665
Bse8I GATNNNNATC 4 cut(s) 1341, 1854, 4497, 4716
BseCI ATCGAT 2 cut(s) 162, 3340
BseJI GATNNNNATC 4 cut(s) 1341, 1854, 4497, 4716
BseMI GCAATG 4 cut(s) 1742, 2602, 4512, 4665
BseRI GAGGAG 4 cut(s) 1088, 2099, 2900, 3720
BseSI GKGCMC 4 cut(s) 192, 1608, 3889, 3900
BseYI CCCAGC 1 cut(s) 56
BsgI GTGCAG 1 cut(s) 1979
BshFI GGCC 4 cut(s) 375, 660, 1341, 3537
BshNI GGYRCC 2 cut(s) 466, 2211
BshTI ACCGGT 1 cut(s) 2067
BshVI ATCGAT 2 cut(s) 162, 3340
BsiHKAI GWGCWC 4 cut(s) 1624, 3712, 3889, 4174
BsiSI CCGG 4 cut(s) 782, 2068, 3473, 3953
BslFI GGGAC 4 cut(s) 2564, 3361, 3720, 4443
BsmAI GTCTC 6 cut(s) 291, 303, 553, 1281, 2760, 4013
BsmBI CGTCTC 1 cut(s) 4013
BsmFI GGGAC 4 cut(s) 2564, 3361, 3720, 4443
BsmI GAATGC 3 cut(s) 1171, 4264, 4586
BsnI GGCC 4 cut(s) 375, 660, 1341, 3537
Bso31I GGTCTC 3 cut(s) 291, 303, 553
Bsp1407I TGTACA 1 cut(s) 4495
Bsp1720I GCTNAGC 1 cut(s) 2429
BspACI CCGC 7 cut(s) 283, 549, 1984, 1994, 2262, 4151, 4471
BspANI GGCC 4 cut(s) 375, 660, 1341, 3537
BspDI ATCGAT 2 cut(s) 162, 3340
BspHI TCATGA 1 cut(s) 4174
BspMAI CTGCAG 2 cut(s) 229, 1807
BspQI GCTCTTC 2 cut(s) 2984, 3130
BspT107I GGYRCC 2 cut(s) 466, 2211
BspTI CTTAAG 1 cut(s) 1769
BspTNI GGTCTC 3 cut(s) 291, 303, 553
BsrDI GCAATG 4 cut(s) 1742, 2602, 4512, 4665
BsrFI RCCGGY 1 cut(s) 2067
BsrGI TGTACA 1 cut(s) 4495
BssAI RCCGGY 1 cut(s) 2067
BssT1I CCWWGG 4 cut(s) 875, 1547, 2140, 4401
Bst4CI ACNGT 7 cut(s) 356, 650, 668, 2124, 2906, 3967, 4700
BstAFI CTTAAG 1 cut(s) 1769
BstAPI GCANNNNNTGC 1 cut(s) 2251
BstAUI TGTACA 1 cut(s) 4495
BstBAI YACGTR 2 cut(s) 3293, 4529
BstC8I GCNNGC 6 cut(s) 2042, 2247, 2962, 4276, 4475, 4656
BstDSI CCRYGG 2 cut(s) 2638, 3299
BstENI CCTNNNNNAGG 1 cut(s) 1923
BstMAI GTCTC 6 cut(s) 291, 303, 553, 1281, 2760, 4013
BstNSI RCATGY 3 cut(s) 2044, 2249, 4477
BstPAI GACNNNNGTC 2 cut(s) 1971, 3276
BstSFI CTRYAG 5 cut(s) 225, 646, 1803, 2905, 3186
BstSLI GKGCMC 4 cut(s) 192, 1608, 3889, 3900
BstSNI TACGTA 1 cut(s) 3293
BstV2I GAAGAC 1 cut(s) 1953
BstX2I RGATCY 9 cut(s) 820, 866, 893, 1672, 2774, 3089, 3617, 3630, 3910
BstXI CCANNNNNNTGG 5 cut(s) 2028, 2237, 2446, 4198, 4427
BstYI RGATCY 9 cut(s) 820, 866, 893, 1672, 2774, 3089, 3617, 3630, 3910
Bsu15I ATCGAT 2 cut(s) 162, 3340
Bsu36I CCTNAGG 1 cut(s) 816
BsuI GTATCC 3 cut(s) 540, 1684, 3652
BsuRI GGCC 4 cut(s) 375, 660, 1341, 3537
BsuTUI ATCGAT 2 cut(s) 162, 3340
BtgI CCRYGG 2 cut(s) 2638, 3299
BtgZI GCGATG 1 cut(s) 4245
BtsI GCAGTG 4 cut(s) 1967, 2457, 2977, 4146
Cac8I GCNNGC 6 cut(s) 2042, 2247, 2962, 4276, 4475, 4656
CaiI CAGNNNCTG 5 cut(s) 1919, 2428, 3605, 3749, 4547
CciI TCATGA 1 cut(s) 4174
Cfr10I RCCGGY 1 cut(s) 2067
Cfr13I GGNCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
ClaI ATCGAT 2 cut(s) 162, 3340
CseI GACGC 1 cut(s) 4520
CspAI ACCGGT 1 cut(s) 2067
CspCI CAANNNNNGTGG 2 cut(s) 2953, 2988
DraI TTTAAA 3 cut(s) 360, 1329, 2532
DriI GACNNNNNGTC 2 cut(s) 777, 3732
EaeI YGGCCR 3 cut(s) 373, 1339, 3535
Eam1105I GACNNNNNGTC 2 cut(s) 777, 3732
Ecl136II GAGCTC 1 cut(s) 3710
Eco105I TACGTA 1 cut(s) 3293
Eco130I CCWWGG 4 cut(s) 875, 1547, 2140, 4401
Eco24I GRGCYC 4 cut(s) 614, 1933, 3712, 4606
Eco31I GGTCTC 3 cut(s) 291, 303, 553
Eco32I GATATC 1 cut(s) 643
Eco47I GGWCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
Eco53kI GAGCTC 1 cut(s) 3710
Eco72I CACGTG 1 cut(s) 4529
Eco81I CCTNAGG 1 cut(s) 816
EcoICRI GAGCTC 1 cut(s) 3710
EcoNI CCTNNNNNAGG 1 cut(s) 1923
EcoO109I RGGNCCY 3 cut(s) 1551, 2516, 4316
EcoRV GATATC 1 cut(s) 643
EcoT14I CCWWGG 4 cut(s) 875, 1547, 2140, 4401
EcoT22I ATGCAT 1 cut(s) 4586
EcoT38I GRGCYC 4 cut(s) 614, 1933, 3712, 4606
ErhI CCWWGG 4 cut(s) 875, 1547, 2140, 4401
Esp3I CGTCTC 1 cut(s) 4013
FalI AAGNNNNNCTT 6 cut(s) 1752, 1784, 3928, 3960, 4379, 4411
FaqI GGGAC 4 cut(s) 2564, 3361, 3720, 4443
FauI CCCGC 1 cut(s) 2255
FauNDI CATATG 1 cut(s) 2847
FbaI TGATCA 1 cut(s) 2218
FblI GTMKAC 3 cut(s) 626, 2781, 4383
FriOI GRGCYC 4 cut(s) 614, 1933, 3712, 4606
GsaI CCCAGC 1 cut(s) 60
GsuI CTGGAG 5 cut(s) 273, 297, 746, 1567, 3723
HaeIII GGCC 4 cut(s) 375, 660, 1341, 3537
HapII CCGG 4 cut(s) 782, 2068, 3473, 3953
HgaI GACGC 1 cut(s) 4520
HincII GTYRAC 4 cut(s) 627, 1196, 1810, 2389
HindII GTYRAC 4 cut(s) 627, 1196, 1810, 2389
HindIII AAGCTT 3 cut(s) 1634, 1766, 2374
HpaI GTTAAC 2 cut(s) 1810, 2389
HpaII CCGG 4 cut(s) 782, 2068, 3473, 3953
Hpy99I CGWCG 1 cut(s) 146
HpyCH4III ACNGT 7 cut(s) 356, 650, 668, 2124, 2906, 3967, 4700
HpyCH4IV ACGT 5 cut(s) 144, 3016, 3292, 4528, 4642
HpySE526I ACGT 5 cut(s) 144, 3016, 3292, 4528, 4642
Ksp22I TGATCA 1 cut(s) 2218
KspAI GTTAAC 2 cut(s) 1810, 2389
LguI GCTCTTC 2 cut(s) 2984, 3130
MaeII ACGT 5 cut(s) 144, 3016, 3292, 4528, 4642
MfeI CAATTG 2 cut(s) 1748, 4675
MflI RGATCY 9 cut(s) 820, 866, 893, 1672, 2774, 3089, 3617, 3630, 3910
MlsI TGGCCA 3 cut(s) 375, 1341, 3537
MluNI TGGCCA 3 cut(s) 375, 1341, 3537
MlyI GAGTC 9 cut(s) 304, 1376, 1661, 2960, 3061, 3272, 3721, 4133, 4699
MmeI TCCRAC 1 cut(s) 397
Mox20I TGGCCA 3 cut(s) 375, 1341, 3537
Mph1103I ATGCAT 1 cut(s) 4586
MroXI GAANNNNTTC 2 cut(s) 430, 3940
MscI TGGCCA 3 cut(s) 375, 1341, 3537
MslI CAYNNNNRTG 4 cut(s) 2876, 3304, 4179, 4269
Msp20I TGGCCA 3 cut(s) 375, 1341, 3537
MspA1I CMGCKG 4 cut(s) 283, 2262, 2428, 4544
MspCI CTTAAG 1 cut(s) 1769
MspI CCGG 4 cut(s) 782, 2068, 3473, 3953
MunI CAATTG 2 cut(s) 1748, 4675
Mva1269I GAATGC 3 cut(s) 1171, 4264, 4586
NciI CCSGG 2 cut(s) 3474, 3953
NdeI CATATG 1 cut(s) 2847
NmuCI GTSAC 5 cut(s) 804, 1964, 2441, 3264, 3681
NsiI ATGCAT 1 cut(s) 4586
NspI RCATGY 3 cut(s) 2044, 2249, 4477
PaeI GCATGC 3 cut(s) 2044, 2249, 4477
PagI TCATGA 1 cut(s) 4174
PciSI GCTCTTC 2 cut(s) 2984, 3130
PcsI WCGNNNNNNNCGW 3 cut(s) 141, 159, 3736
PctI GAATGC 3 cut(s) 1171, 4264, 4586
PdmI GAANNNNTTC 2 cut(s) 430, 3940
PflMI CCANNNNNTGG 3 cut(s) 3701, 3749, 4700
PinAI ACCGGT 1 cut(s) 2067
PleI GAGTC 9 cut(s) 304, 1376, 1660, 2959, 3060, 3271, 3721, 4132, 4698
PmaCI CACGTG 1 cut(s) 4529
PmlI CACGTG 1 cut(s) 4529
PpsI GAGTC 9 cut(s) 304, 1376, 1660, 2959, 3060, 3271, 3721, 4132, 4698
Ppu21I YACGTR 2 cut(s) 3293, 4529
PpuMI RGGWCCY 3 cut(s) 1551, 2516, 4316
PshAI GACNNNNGTC 2 cut(s) 1971, 3276
PshBI ATTAAT 1 cut(s) 1940
Psp124BI GAGCTC 1 cut(s) 3712
Psp5II RGGWCCY 3 cut(s) 1551, 2516, 4316
PspCI CACGTG 1 cut(s) 4529
PspFI CCCAGC 1 cut(s) 56
PspPI GGNCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
PspPPI RGGWCCY 3 cut(s) 1551, 2516, 4316
PsrI GAACNNNNNNTAC 2 cut(s) 3850, 3882
PstI CTGCAG 2 cut(s) 229, 1807
PstNI CAGNNNCTG 5 cut(s) 1919, 2428, 3605, 3749, 4547
PsuI RGATCY 9 cut(s) 820, 866, 893, 1672, 2774, 3089, 3617, 3630, 3910
PvuII CAGCTG 2 cut(s) 2428, 4544
RseI CAYNNNNRTG 4 cut(s) 2876, 3304, 4179, 4269
SacI GAGCTC 1 cut(s) 3712
SalI GTCGAC 1 cut(s) 625
SapI GCTCTTC 2 cut(s) 2984, 3130
Sau96I GGNCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
ScaI AGTACT 2 cut(s) 1417, 3246
SchI GAGTC 9 cut(s) 304, 1376, 1661, 2960, 3061, 3272, 3721, 4133, 4699
SfcI CTRYAG 5 cut(s) 225, 646, 1803, 2905, 3186
SinI GGWCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
SmiMI CAYNNNNRTG 4 cut(s) 2876, 3304, 4179, 4269
SmlI CTYRAG 6 cut(s) 365, 590, 726, 1769, 2668, 4010
SmoI CTYRAG 6 cut(s) 365, 590, 726, 1769, 2668, 4010
SnaBI TACGTA 1 cut(s) 3293
SpeI ACTAGT 2 cut(s) 752, 3869
SphI GCATGC 3 cut(s) 2044, 2249, 4477
SsiI CCGC 7 cut(s) 283, 549, 1984, 1994, 2262, 4151, 4471
SstI GAGCTC 1 cut(s) 3712
StyI CCWWGG 4 cut(s) 875, 1547, 2140, 4401
TaaI ACNGT 7 cut(s) 356, 650, 668, 2124, 2906, 3967, 4700
TaiI ACGT 5 cut(s) 147, 3019, 3295, 4531, 4645
TaqI TCGA 8 cut(s) 135, 162, 626, 2707, 3340, 3652, 4285, 4450
TatI WGTACW 5 cut(s) 1415, 2472, 3244, 3826, 4495
TauI GCSGC 2 cut(s) 1987, 4154
TseFI GTSAC 5 cut(s) 804, 1964, 2441, 3264, 3681
Tsp45I GTSAC 5 cut(s) 804, 1964, 2441, 3264, 3681
TspGWI ACGGA 8 cut(s) 1911, 2096, 2476, 2655, 2767, 2787, 3064, 3316
Van91I CCANNNNNTGG 3 cut(s) 3701, 3749, 4700
Vha464I CTTAAG 1 cut(s) 1769
VneI GTGCAC 1 cut(s) 3885
VpaK11BI GGWCC 9 cut(s) 722, 1045, 1429, 1551, 1898, 2516, 2642, 2660, 4316
VspI ATTAAT 1 cut(s) 1940
XagI CCTNNNNNAGG 1 cut(s) 1923
XapI RAATTY 7 cut(s) 171, 1542, 2233, 2841, 4064, 4134, 4481
XbaI TCTAGA 2 cut(s) 2570, 2798
XceI RCATGY 3 cut(s) 2044, 2249, 4477
XcmI CCANNNNNNNNNTGG 1 cut(s) 3518
XmiI GTMKAC 3 cut(s) 626, 2781, 4383
XmnI GAANNNNTTC 2 cut(s) 430, 3940
ZrmI AGTACT 2 cut(s) 1417, 3246
Zsp2I ATGCAT 1 cut(s) 4586
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.