Rmu_sc0001211.1_g000115

Plasma membrane ATPase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001211.1
OG0002698
Physical Location & Seq
Forward (+)
445892 .. 446917
1026 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001211.1_g000115.1.cds

Sequence Viewer

Length: 513 bp
atggccaatggtttcgatttcggttggtgctactgtcctactgatgttgatggtataattgctaaattgctgatttgcagaaatgatataattgcttggcctatggagtatggagtgtttgctaaagatgttgaaaaagactcggttgtattgatggctgcaagtctacaaattgatgacctcattcagaatgctgatggctttgctggtatctttccagagcataaatatgagattgttcagcgattacaaattaagaagcacatagttggaatgaccggtgatggagttaatgatgcacctgccttgaagaaagcagacataggaattgctgtggcagatgtcacagatgctgctcgtagtgcgtctgatatagtactgacacagcctggattgagtgttattattagtgttgttctgacaagccgtgcaatctttcaaagaatgaagaactacacagtaaggggattctcccttctcatttttttaggaattggactagcctggtcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

170

Amino Acids

18.49

Weight (kDa)

5.04

Isoelectric Point (pI)

20.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 310
Acc36I ACCTGC 1 cut(s) 310
AccI GTMKAC 1 cut(s) 166
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 378
AgeI ACCGGT 1 cut(s) 278
AgsI TTSAA 3 cut(s) 134, 310, 440
AjnI CCWGG 2 cut(s) 388, 503
AlwNI CAGNNNCTG 1 cut(s) 353
AoxI GGCC 2 cut(s) 3, 98
ApeKI GCWGC 2 cut(s) 158, 353
AsiGI ACCGGT 1 cut(s) 278
AsuHPI GGTGA 1 cut(s) 293
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 2 cut(s) 145, 340
BccI CCATC 4 cut(s) 44, 148, 191, 278
BceAI ACGGC 1 cut(s) 411
BciT130I CCWGG 2 cut(s) 390, 505
BfaI CTAG 1 cut(s) 500
BfuAI ACCTGC 1 cut(s) 310
BisI GCNGC 2 cut(s) 159, 354
BlsI GCNGC 2 cut(s) 160, 355
BmcAI AGTACT 1 cut(s) 378
Bme1390I CCNGG 2 cut(s) 390, 505
BmrFI CCNGG 2 cut(s) 390, 505
BmsI GCATC 2 cut(s) 286, 340
BsaWI WCCGGW 1 cut(s) 278
Bse118I RCCGGY 1 cut(s) 278
BseBI CCWGG 2 cut(s) 390, 505
BseXI GCAGC 2 cut(s) 145, 340
BshFI GGCC 2 cut(s) 5, 100
BshTI ACCGGT 1 cut(s) 278
BsiSI CCGG 1 cut(s) 279
BsmI GAATGC 1 cut(s) 196
BsnI GGCC 2 cut(s) 5, 100
BspANI GGCC 2 cut(s) 5, 100
BspMI ACCTGC 1 cut(s) 310
BsrFI RCCGGY 1 cut(s) 278
BssAI RCCGGY 1 cut(s) 278
Bst2UI CCWGG 2 cut(s) 390, 505
Bst4CI ACNGT 2 cut(s) 35, 460
BstMWI GCNNNNNNNGC 1 cut(s) 362
BstNI CCWGG 2 cut(s) 390, 505
BstSCI CCNGG 2 cut(s) 388, 503
BstV1I GCAGC 2 cut(s) 145, 340
BsuRI GGCC 2 cut(s) 5, 100
BveI ACCTGC 1 cut(s) 310
CaiI CAGNNNCTG 1 cut(s) 353
Cfr10I RCCGGY 1 cut(s) 278
CseI GACGC 1 cut(s) 354
Csp6I GTAC 1 cut(s) 377
CspAI ACCGGT 1 cut(s) 278
CviJI RGCY 7 cut(s) 5, 100, 158, 201, 388, 426, 503
CviKI_1 RGCY 7 cut(s) 5, 100, 158, 201, 388, 426, 503
CviQI GTAC 1 cut(s) 377
EaeI YGGCCR 1 cut(s) 3
EcoRII CCWGG 2 cut(s) 388, 503
FaiI YATR 9 cut(s) 56, 89, 104, 111, 225, 231, 266, 323, 374
FblI GTMKAC 1 cut(s) 166
Fnu4HI GCNGC 2 cut(s) 159, 354
Fsp4HI GCNGC 2 cut(s) 159, 354
FspBI CTAG 1 cut(s) 500
GluI GCNGC 2 cut(s) 159, 354
HaeIII GGCC 2 cut(s) 5, 100
HapII CCGG 1 cut(s) 279
HgaI GACGC 1 cut(s) 354
HinfI GANTC 2 cut(s) 140, 468
HpaII CCGG 1 cut(s) 279
HphI GGTGA 1 cut(s) 293
Hpy166II GTNNAC 1 cut(s) 167
Hpy188I TCNGA 3 cut(s) 189, 370, 420
Hpy188III TCNNGA 1 cut(s) 218
Hpy8I GTNNAC 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 485
HpyCH4III ACNGT 2 cut(s) 35, 460
HpyCH4V TGCA 4 cut(s) 78, 161, 299, 431
HpyF10VI GCNNNNNNNGC 1 cut(s) 362
LpnPI CCDG 7 cut(s) 192, 231, 292, 315, 375, 402, 490
Lsp1109I GCAGC 2 cut(s) 145, 340
LweI GCATC 2 cut(s) 286, 340
MaeI CTAG 1 cut(s) 500
MaeIII GTNAC 1 cut(s) 343
MboII GAAGA 2 cut(s) 322, 460
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 7 cut(s) 57, 65, 90, 171, 252, 327, 492
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 134
MmeI TCCRAC 1 cut(s) 250
MnlI CCTC 1 cut(s) 191
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 255, 291
MslI CAYNNNNRTG 1 cut(s) 228
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 1 cut(s) 279
MspR9I CCNGG 2 cut(s) 390, 505
Mva1269I GAATGC 1 cut(s) 196
MvaI CCWGG 2 cut(s) 390, 505
MwoI GCNNNNNNNGC 1 cut(s) 362
NmuCI GTSAC 1 cut(s) 343
PaqCI CACCTGC 1 cut(s) 310
PctI GAATGC 1 cut(s) 196
PfeI GAWTC 1 cut(s) 468
PinAI ACCGGT 1 cut(s) 278
PkrI GCNGC 2 cut(s) 160, 355
PleI GAGTC 1 cut(s) 134
PpsI GAGTC 1 cut(s) 134
Psp6I CCWGG 2 cut(s) 388, 503
PspGI CCWGG 2 cut(s) 388, 503
PstNI CAGNNNCTG 1 cut(s) 353
RsaI GTAC 1 cut(s) 378
RsaNI GTAC 1 cut(s) 377
RseI CAYNNNNRTG 1 cut(s) 228
SaqAI TTAA 2 cut(s) 255, 291
SatI GCNGC 2 cut(s) 159, 354
ScaI AGTACT 1 cut(s) 378
SchI GAGTC 1 cut(s) 134
ScrFI CCNGG 2 cut(s) 390, 505
SetI ASST 2 cut(s) 183, 304
SfaNI GCATC 2 cut(s) 286, 340
SmiMI CAYNNNNRTG 1 cut(s) 228
Sse9I AATT 7 cut(s) 57, 65, 90, 171, 252, 327, 492
SspMI CTAG 1 cut(s) 500
StyD4I CCNGG 2 cut(s) 388, 503
TaaI ACNGT 2 cut(s) 35, 460
TaqI TCGA 1 cut(s) 15
TasI AATT 7 cut(s) 57, 65, 90, 171, 252, 327, 492
TatI WGTACW 1 cut(s) 376
TfiI GAWTC 1 cut(s) 468
Tru1I TTAA 2 cut(s) 255, 291
Tru9I TTAA 2 cut(s) 255, 291
TseFI GTSAC 1 cut(s) 343
TseI GCWGC 2 cut(s) 158, 353
Tsp45I GTSAC 1 cut(s) 343
TspDTI ATGAA 1 cut(s) 461
XmiI GTMKAC 1 cut(s) 166
XspI CTAG 1 cut(s) 500
ZrmI AGTACT 1 cut(s) 378
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.