Rmu_sc0007327.1_g000001

Plasma membrane ATPase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007327.1
OG0002698
Physical Location & Seq
Forward (+)
1 .. 477
477 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007327.1_g000001.1.cds

Sequence Viewer

Length: 397 bp
tccatcatcttcattgcttggtgaaaataagaatggattagatgcaagtctacaaattgatgaactcattgagaatgctgacggttttgctggtatctttccagagcataaatatgagattgttcagcgattacaaattaagaagcacatagttggaatgaccggtgatggagttaatgatgcacctgccttgaagaaagcagacataggaattgctgtggcagatgccacagatgctgctcgtagtgcgtctgatatagtactgacacagcctggattgagtgttattattagtgttgttctgacaagccgtgcaatctttcaaagaatgaagaactacacagtaaggggattctcccttctcatttttttaggaattggaccagcctggtcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

131

Amino Acids

13.95

Weight (kDa)

5.6

Isoelectric Point (pI)

31.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 194
Acc36I ACCTGC 1 cut(s) 194
AccI GTMKAC 1 cut(s) 50
AfaI GTAC 1 cut(s) 262
AgeI ACCGGT 1 cut(s) 162
AgsI TTSAA 2 cut(s) 194, 324
AjnI CCWGG 2 cut(s) 272, 387
AlwNI CAGNNNCTG 1 cut(s) 237
ApeKI GCWGC 1 cut(s) 237
AsiGI ACCGGT 1 cut(s) 162
AspS9I GGNCC 1 cut(s) 381
AsuHPI GGTGA 2 cut(s) 33, 177
AvaII GGWCC 1 cut(s) 381
BbvI GCAGC 1 cut(s) 224
BccI CCATC 2 cut(s) 11, 162
BceAI ACGGC 1 cut(s) 295
BciT130I CCWGG 2 cut(s) 274, 389
BfuAI ACCTGC 1 cut(s) 194
BisI GCNGC 1 cut(s) 238
BlsI GCNGC 1 cut(s) 239
BmcAI AGTACT 1 cut(s) 262
Bme1390I CCNGG 2 cut(s) 274, 389
Bme18I GGWCC 1 cut(s) 381
BmgT120I GGNCC 1 cut(s) 381
BmrFI CCNGG 2 cut(s) 274, 389
BmsI GCATC 4 cut(s) 32, 170, 215, 224
BsaWI WCCGGW 1 cut(s) 162
Bse118I RCCGGY 1 cut(s) 162
Bse3DI GCAATG 1 cut(s) 12
BseBI CCWGG 2 cut(s) 274, 389
BseMI GCAATG 1 cut(s) 12
BseXI GCAGC 1 cut(s) 224
BshTI ACCGGT 1 cut(s) 162
BsiSI CCGG 1 cut(s) 163
BsmI GAATGC 1 cut(s) 80
BspMI ACCTGC 1 cut(s) 194
BsrDI GCAATG 1 cut(s) 12
BsrFI RCCGGY 1 cut(s) 162
BssAI RCCGGY 1 cut(s) 162
Bst2UI CCWGG 2 cut(s) 274, 389
Bst4CI ACNGT 2 cut(s) 84, 344
BstMWI GCNNNNNNNGC 2 cut(s) 234, 246
BstNI CCWGG 2 cut(s) 274, 389
BstSCI CCNGG 2 cut(s) 272, 387
BstV1I GCAGC 1 cut(s) 224
BveI ACCTGC 1 cut(s) 194
CaiI CAGNNNCTG 1 cut(s) 237
Cfr10I RCCGGY 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 381
CseI GACGC 1 cut(s) 238
Csp6I GTAC 1 cut(s) 261
CspAI ACCGGT 1 cut(s) 162
CviJI RGCY 3 cut(s) 272, 310, 387
CviKI_1 RGCY 3 cut(s) 272, 310, 387
CviQI GTAC 1 cut(s) 261
Eco47I GGWCC 1 cut(s) 381
EcoRII CCWGG 2 cut(s) 272, 387
FaiI YATR 5 cut(s) 109, 115, 150, 207, 258
FblI GTMKAC 1 cut(s) 50
Fnu4HI GCNGC 1 cut(s) 238
Fsp4HI GCNGC 1 cut(s) 238
GluI GCNGC 1 cut(s) 238
HapII CCGG 1 cut(s) 163
HgaI GACGC 1 cut(s) 238
HinfI GANTC 1 cut(s) 352
HpaII CCGG 1 cut(s) 163
HphI GGTGA 2 cut(s) 33, 177
Hpy166II GTNNAC 1 cut(s) 51
Hpy188I TCNGA 2 cut(s) 254, 304
Hpy188III TCNNGA 1 cut(s) 102
Hpy8I GTNNAC 1 cut(s) 51
HpyAV CCTTC 1 cut(s) 369
HpyCH4III ACNGT 2 cut(s) 84, 344
HpyCH4V TGCA 3 cut(s) 45, 183, 315
HpyF10VI GCNNNNNNNGC 2 cut(s) 234, 246
LpnPI CCDG 7 cut(s) 76, 115, 176, 199, 259, 286, 374
Lsp1109I GCAGC 1 cut(s) 224
LweI GCATC 4 cut(s) 32, 170, 215, 224
MboII GAAGA 2 cut(s) 206, 344
MluCI AATT 4 cut(s) 55, 136, 211, 376
MmeI TCCRAC 1 cut(s) 134
MseI TTAA 2 cut(s) 139, 175
MslI CAYNNNNRTG 1 cut(s) 112
MspI CCGG 1 cut(s) 163
MspR9I CCNGG 2 cut(s) 274, 389
Mva1269I GAATGC 1 cut(s) 80
MvaI CCWGG 2 cut(s) 274, 389
MwoI GCNNNNNNNGC 2 cut(s) 234, 246
PaqCI CACCTGC 1 cut(s) 194
PctI GAATGC 1 cut(s) 80
PfeI GAWTC 1 cut(s) 352
PinAI ACCGGT 1 cut(s) 162
PkrI GCNGC 1 cut(s) 239
Psp6I CCWGG 2 cut(s) 272, 387
PspGI CCWGG 2 cut(s) 272, 387
PspPI GGNCC 1 cut(s) 381
PstNI CAGNNNCTG 1 cut(s) 237
RsaI GTAC 1 cut(s) 262
RsaNI GTAC 1 cut(s) 261
RseI CAYNNNNRTG 1 cut(s) 112
SaqAI TTAA 2 cut(s) 139, 175
SatI GCNGC 1 cut(s) 238
Sau96I GGNCC 1 cut(s) 381
ScaI AGTACT 1 cut(s) 262
ScrFI CCNGG 2 cut(s) 274, 389
SetI ASST 1 cut(s) 188
SfaNI GCATC 4 cut(s) 32, 170, 215, 224
SinI GGWCC 1 cut(s) 381
SmiMI CAYNNNNRTG 1 cut(s) 112
Sse9I AATT 4 cut(s) 55, 136, 211, 376
StyD4I CCNGG 2 cut(s) 272, 387
TaaI ACNGT 2 cut(s) 84, 344
TasI AATT 4 cut(s) 55, 136, 211, 376
TatI WGTACW 1 cut(s) 260
TfiI GAWTC 1 cut(s) 352
Tru1I TTAA 2 cut(s) 139, 175
Tru9I TTAA 2 cut(s) 139, 175
TseI GCWGC 1 cut(s) 237
TspDTI ATGAA 2 cut(s) 76, 345
VpaK11BI GGWCC 1 cut(s) 381
XmiI GTMKAC 1 cut(s) 50
ZrmI AGTACT 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.