Rmu_sc0001320.1_g000013

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001320.1
OG0014716
Physical Location & Seq
Forward (+)
40005 .. 40505
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001320.1_g000013.1.cds

Sequence Viewer

Length: 501 bp
atggagtatagacatggagcacgtaaattcgttgatactgttcaggcgagtttggggaatccagaaagaattaggtgtccttgcattgattgcagaaatgcaaaacgtcataactataacatagtttatgaccacttgattgtaccggggatgaatcctttatacactaagtggatatttcatggggaagggacaacaattgcaggaacacatgataacactgaggttccagcaacatatcgaatgcttagggatgcatgtttggaaaatgatgatgttagggaacctacaaacaacgaatatgtgtttgattatgaaaatttattagaggaggcagaacttcctctctatggaggaagtggctggacaaaaatgtctgcaacagtagccttgtataagttcaaggcaagacatagtctatcaaacactggttttgatgaacttcttgagatgattggtgggtttttaccaaatgatcacattcttccgaattctttataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 Transpos_assoc

Protein Analysis

166

Amino Acids

18.96

Weight (kDa)

5.44

Isoelectric Point (pI)

36.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 499
AasI GACNNNNNNGTC 1 cut(s) 373
AcsI RAATTY 3 cut(s) 26, 319, 490
AdeI CACNNNGTG 1 cut(s) 171
AfaI GTAC 1 cut(s) 144
AfiI CCNNNNNNNGG 1 cut(s) 350
AgsI TTSAA 1 cut(s) 403
Alw21I GWGCWC 1 cut(s) 22
ApoI RAATTY 3 cut(s) 26, 319, 490
AsuC2I CCSGG 1 cut(s) 147
Bbv12I GWGCWC 1 cut(s) 22
BclI TGATCA 1 cut(s) 475
BcnI CCSGG 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 147
BmiI GGNNCC 2 cut(s) 228, 285
BmrFI CCNGG 1 cut(s) 147
BmsI GCATC 1 cut(s) 244
Bpu10I CCTNAGC 1 cut(s) 248
BpuEI CTTGAG 1 cut(s) 467
BpuMI CCSGG 1 cut(s) 147
BsaAI YACGTR 1 cut(s) 23
BsaJI CCNNGG 1 cut(s) 146
Bsc4I CCNNNNNNNGG 1 cut(s) 350
Bse1I ACTGG 1 cut(s) 433
BseDI CCNNGG 1 cut(s) 146
BseGI GGATG 2 cut(s) 156, 259
BseLI CCNNNNNNNGG 1 cut(s) 350
BseMII CTCAG 1 cut(s) 213
BseNI ACTGG 1 cut(s) 433
BseRI GAGGAG 1 cut(s) 344
BsiHKAI GWGCWC 1 cut(s) 22
BsiSI CCGG 1 cut(s) 146
BslFI GGGAC 1 cut(s) 205
BslI CCNNNNNNNGG 1 cut(s) 350
BsmFI GGGAC 1 cut(s) 205
BsmI GAATGC 1 cut(s) 249
Bsp1286I GDGCHC 1 cut(s) 22
Bsp143I GATC 1 cut(s) 475
BspCNI CTCAG 1 cut(s) 214
BspLI GGNNCC 2 cut(s) 228, 285
BsrI ACTGG 1 cut(s) 433
BssECI CCNNGG 1 cut(s) 146
BssMI GATC 1 cut(s) 475
Bst4CI ACNGT 2 cut(s) 40, 385
BstAPI GCANNNNNTGC 1 cut(s) 90
BstBAI YACGTR 1 cut(s) 23
BstDEI CTNAG 3 cut(s) 168, 222, 248
BstF5I GGATG 2 cut(s) 156, 259
BstKTI GATC 1 cut(s) 478
BstMBI GATC 1 cut(s) 475
BstMWI GCNNNNNNNGC 2 cut(s) 90, 386
BstNSI RCATGY 1 cut(s) 261
BstSCI CCNGG 1 cut(s) 145
BtsCI GGATG 2 cut(s) 156, 259
BtsIMutI CAGTG 2 cut(s) 219, 426
Csp6I GTAC 1 cut(s) 143
CviAII CATG 4 cut(s) 14, 182, 212, 258
CviJI RGCY 2 cut(s) 363, 389
CviKI_1 RGCY 2 cut(s) 363, 389
CviQI GTAC 1 cut(s) 143
DdeI CTNAG 3 cut(s) 168, 222, 248
DpnI GATC 1 cut(s) 477
DpnII GATC 1 cut(s) 475
DraIII CACNNNGTG 1 cut(s) 171
DrdI GACNNNNNNGTC 1 cut(s) 373
DseDI GACNNNNNNGTC 1 cut(s) 373
EcoRI GAATTC 1 cut(s) 490
EcoT22I ATGCAT 1 cut(s) 259
FaeI CATG 4 cut(s) 17, 185, 215, 261
FaqI GGGAC 1 cut(s) 205
FatI CATG 4 cut(s) 13, 181, 211, 257
FbaI TGATCA 1 cut(s) 475
FokI GGATG 2 cut(s) 163, 266
HapII CCGG 1 cut(s) 146
Hin1II CATG 4 cut(s) 17, 185, 215, 261
HinfI GANTC 2 cut(s) 58, 154
HpaII CCGG 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 489
Hpy188III TCNNGA 2 cut(s) 62, 446
HpyAV CCTTC 1 cut(s) 182
HpyCH4III ACNGT 2 cut(s) 40, 385
HpyCH4IV ACGT 2 cut(s) 22, 106
HpyCH4V TGCA 6 cut(s) 84, 93, 101, 203, 257, 380
HpyF10VI GCNNNNNNNGC 2 cut(s) 90, 386
HpyF3I CTNAG 3 cut(s) 168, 222, 248
HpySE526I ACGT 2 cut(s) 22, 106
Hsp92II CATG 4 cut(s) 17, 185, 215, 261
Ksp22I TGATCA 1 cut(s) 475
Kzo9I GATC 1 cut(s) 475
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 7 cut(s) 29, 75, 159, 189, 243, 349, 414
LweI GCATC 1 cut(s) 244
MaeII ACGT 2 cut(s) 22, 106
MalI GATC 1 cut(s) 477
MboI GATC 1 cut(s) 475
MboII GAAGA 1 cut(s) 476
MfeI CAATTG 1 cut(s) 198
MhlI GDGCHC 1 cut(s) 22
MluCI AATT 5 cut(s) 26, 69, 198, 319, 490
MnlI CCTC 5 cut(s) 217, 322, 325, 347, 354
Mph1103I ATGCAT 1 cut(s) 259
MspI CCGG 1 cut(s) 146
MspR9I CCNGG 1 cut(s) 147
MunI CAATTG 1 cut(s) 198
Mva1269I GAATGC 1 cut(s) 249
MwoI GCNNNNNNNGC 2 cut(s) 90, 386
NciI CCSGG 1 cut(s) 147
NdeII GATC 1 cut(s) 475
NlaIII CATG 4 cut(s) 17, 185, 215, 261
NlaIV GGNNCC 2 cut(s) 228, 285
NsiI ATGCAT 1 cut(s) 259
NspI RCATGY 1 cut(s) 261
PctI GAATGC 1 cut(s) 249
PfeI GAWTC 2 cut(s) 58, 154
PflFI GACNNNGTC 1 cut(s) 414
Ppu21I YACGTR 1 cut(s) 23
PsiI TTATAA 1 cut(s) 499
PspN4I GGNNCC 2 cut(s) 228, 285
PsyI GACNNNGTC 1 cut(s) 414
RsaI GTAC 1 cut(s) 144
RsaNI GTAC 1 cut(s) 143
Sau3AI GATC 1 cut(s) 475
ScrFI CCNGG 1 cut(s) 147
SduI GDGCHC 1 cut(s) 22
SetI ASST 5 cut(s) 25, 77, 109, 228, 289
SfaNI GCATC 1 cut(s) 244
SmlI CTYRAG 1 cut(s) 446
SmoI CTYRAG 1 cut(s) 446
Sse9I AATT 5 cut(s) 26, 69, 198, 319, 490
StyD4I CCNGG 1 cut(s) 145
TaaI ACNGT 2 cut(s) 40, 385
TaiI ACGT 2 cut(s) 25, 109
TaqI TCGA 1 cut(s) 241
TasI AATT 5 cut(s) 26, 69, 198, 319, 490
TfiI GAWTC 2 cut(s) 58, 154
TscAI CASTG 2 cut(s) 226, 433
TspDTI ATGAA 4 cut(s) 167, 170, 330, 453
TspRI CASTG 2 cut(s) 226, 433
Tth111I GACNNNGTC 1 cut(s) 414
XapI RAATTY 3 cut(s) 26, 319, 490
XceI RCATGY 1 cut(s) 261
Zsp2I ATGCAT 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.