Rh3CG072100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
5386142 .. 5386735
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG072100.1

Sequence Viewer

Length: 177 bp
ATGGATCTAAATTCTGTATTACATATATTGAAATACAAAGTCATCATGATACAGAAGGCTGTGGCCGGTCTGGTTGCTGCCCTTTCTGCACTCAAATTGGAGAACAAAGCACAATCAACACTGAAGGAGGGTACTATGCTTGAAGGCAATAGGAAAACTACTGCTGGACACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.28

Weight (kDa)

9.9

Isoelectric Point (pI)

26.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AcoI YGGCCR 1 cut(s) 63
AcsI RAATTY 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 143
AfaI GTAC 1 cut(s) 133
AgsI TTSAA 2 cut(s) 31, 143
AlwI GGATC 1 cut(s) 12
AoxI GGCC 1 cut(s) 63
ApeKI GCWGC 1 cut(s) 77
ApoI RAATTY 1 cut(s) 10
BbvI GCAGC 1 cut(s) 64
BisI GCNGC 1 cut(s) 78
BlsI GCNGC 1 cut(s) 79
Bse118I RCCGGY 1 cut(s) 65
BseXI GCAGC 1 cut(s) 64
BsgI GTGCAG 1 cut(s) 72
BshFI GGCC 1 cut(s) 65
BsiSI CCGG 1 cut(s) 66
BsnI GGCC 1 cut(s) 65
Bsp143I GATC 1 cut(s) 4
BspANI GGCC 1 cut(s) 65
BspHI TCATGA 1 cut(s) 45
BspPI GGATC 1 cut(s) 12
BsrFI RCCGGY 1 cut(s) 65
BssAI RCCGGY 1 cut(s) 65
BssMI GATC 1 cut(s) 4
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstV1I GCAGC 1 cut(s) 64
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 65
BtsIMutI CAGTG 1 cut(s) 119
CciI TCATGA 1 cut(s) 45
Cfr10I RCCGGY 1 cut(s) 65
Csp6I GTAC 1 cut(s) 132
CviAII CATG 1 cut(s) 46
CviJI RGCY 2 cut(s) 59, 65
CviKI_1 RGCY 2 cut(s) 59, 65
CviQI GTAC 1 cut(s) 132
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
EaeI YGGCCR 1 cut(s) 63
Eco57I CTGAAG 1 cut(s) 143
FaeI CATG 1 cut(s) 49
FaiI YATR 4 cut(s) 24, 26, 47, 137
FatI CATG 1 cut(s) 45
Fnu4HI GCNGC 1 cut(s) 78
Fsp4HI GCNGC 1 cut(s) 78
GluI GCNGC 1 cut(s) 78
HaeIII GGCC 1 cut(s) 65
HapII CCGG 1 cut(s) 66
Hin1II CATG 1 cut(s) 49
HpaII CCGG 1 cut(s) 66
Hpy188III TCNNGA 1 cut(s) 46
HpyAV CCTTC 3 cut(s) 49, 118, 137
HpyCH4V TGCA 1 cut(s) 89
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
Hsp92II CATG 1 cut(s) 49
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 56, 79, 150
Lsp1109I GCAGC 1 cut(s) 64
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MflI RGATCY 1 cut(s) 4
MluCI AATT 2 cut(s) 10, 95
MnlI CCTC 1 cut(s) 121
MspI CCGG 1 cut(s) 66
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 1 cut(s) 4
NlaIII CATG 1 cut(s) 49
PagI TCATGA 1 cut(s) 45
PkrI GCNGC 1 cut(s) 79
PsuI RGATCY 1 cut(s) 4
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
SatI GCNGC 1 cut(s) 78
Sau3AI GATC 1 cut(s) 4
SgeI CNNG 4 cut(s) 58, 78, 83, 152
Sse9I AATT 2 cut(s) 10, 95
TasI AATT 2 cut(s) 10, 95
TscAI CASTG 1 cut(s) 126
TseI GCWGC 1 cut(s) 77
TspRI CASTG 1 cut(s) 126
XapI RAATTY 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.