Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001334.1

Orthogroup ID

OG0005950

Physical Location & Seq

Genomic Coordinates Reverse (-)

127351 .. 129275

Gene Structure 1925 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001334.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 981 bp

atggatattgaagcaaaaggtattgatcagaaggaaaaggatctgaatgattggcttcccatcacaagttctaggactgcaacctggtggtactcagctttccacaatgtcaccgccatggttggtgctggtgtgcttggtcttccctttgccatgtctcaacttggatggggacctggagttactgtgattgttctttcatggattatcaccctatacaccttatggcagatggtagagatgcatgagtcggtgccggggaagaggtttgataggtaccatgagttgggtcaacatgccttcggagaaaagctagggctttggattgtggtaccccaacaactaatggtgcaatctggtacgtgcatcgtctatatgattactggtggtaaatcactgcagaagatccatgataccgtgtcccctggaaaaccaatcaaaaccacctacttcatcatgatcttcgctgctgtccactttgttatctctcacctccctagtttcaattccattgctggtatttctcttgctgcagctgtcatgtccttgagctactctacagttgcttggggagcttcacttcacaaaggggttcaaccagaagtgcagtatggccccagggcttcgaccaacacaggaaatgtgttcaacttctttagtgctttgggagatgtagctttttcttttgctggtcacaatgtggttttggagattcaagcaacacttccttctacacctgacaagccttccaaaaaaccaatgtggaagggtgtggtgcttgcatatgttgtggtggctttgtgctatttcccagttgctcttatcggttattgggtgttcggaaacagtgttcaggataatatcctcatatcattggagaaacctaagtggcttattgtttctgctaatgcctttgttgttattcatgtcattgggagctatcaggtagagtcctacttcaatatttacattcctgcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aa_trans

Protein Analysis

326

Amino Acids

35.89

Weight (kDa)

7.79

Isoelectric Point (pI)

31.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005950)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g07660
malus_domestica	MD06G1148600.v1.1 MD14G1162700.v1.1
prunus_persica	Prupe.5G155600_v2.0.a1 Prupe.5G155600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0380391 RchiOBHm_Chr5g0057301 RchiOBHm_Chr7g0190811
rosa_laevigata	RLG00000004492 RLG00000004494 RLG00000026307
rosa_multiflora	Rmu_sc0001334.1_g000017 Rmu_sc0005371.1_g000002
rosa_roxburghii	Rroxscaffold_3G00264280 Rroxscaffold_4G00279430
rosa_rugosa	Rorug01G0420300 Rorug01G0420400 Rorug01G0420500 Rorug06G0507300
rosa_samantha	Rh1BG399900 Rh1CG414600 Rh7AG113900 Rh7BG116500 Rh7CG119200
rosa_wichuraiana	Rw1G038710 Rw5G035360 Rw7G009940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	2 cut(s)	276, 331
AccB1I	GGYRCC	3 cut(s)	253, 276, 331
AccB7I	CCANNNNNTGG	1 cut(s)	286
AciI	CCGC	1 cut(s)	114
AclWI	GGATC	2 cut(s)	48, 400
AdeI	CACNNNGTG	1 cut(s)	700
AfaI	GTAC	4 cut(s)	92, 278, 333, 361
AfiI	CCNNNNNNNGG	1 cut(s)	286
AgsI	TTSAA	6 cut(s)	11, 505, 596, 649, 716, 961
AjnI	CCWGG	4 cut(s)	83, 175, 424, 617
AloI	GAACNNNNNNTCC	2 cut(s)	834, 866
AluBI	AGCT	7 cut(s)	98, 313, 536, 552, 575, 677, 939
AluI	AGCT	7 cut(s)	98, 313, 536, 552, 575, 677, 939
Alw26I	GTCTC	1 cut(s)	162
AlwI	GGATC	2 cut(s)	48, 400
AoxI	GGCC	1 cut(s)	613
ApeKI	GCWGC	3 cut(s)	467, 530, 533
Asp718I	GGTACC	2 cut(s)	276, 331
AspS9I	GGNCC	2 cut(s)	173, 614
AsuC2I	CCSGG	1 cut(s)	258
AsuHPI	GGTGA	3 cut(s)	103, 202, 482
AvaII	GGWCC	1 cut(s)	173
BanI	GGYRCC	3 cut(s)	253, 276, 331
BbsI	GAAGAC	1 cut(s)	134
BbvI	GCAGC	3 cut(s)	454, 517, 545
BccI	CCATC	3 cut(s)	68, 162, 226
BciT130I	CCWGG	4 cut(s)	85, 177, 426, 619
BclI	TGATCA	1 cut(s)	25
BcnI	CCSGG	1 cut(s)	258
BcoDI	GTCTC	1 cut(s)	162
BfaI	CTAG	3 cut(s)	72, 314, 498
BfmI	CTRYAG	3 cut(s)	398, 531, 558
BisI	GCNGC	3 cut(s)	468, 531, 534
BlsI	GCNGC	3 cut(s)	469, 532, 535
Bme1390I	CCNGG	5 cut(s)	85, 177, 258, 426, 619
Bme18I	GGWCC	1 cut(s)	173
BmgT120I	GGNCC	2 cut(s)	173, 614
BmiI	GGNNCC	5 cut(s)	174, 255, 278, 333, 616
BmrFI	CCNGG	5 cut(s)	85, 177, 258, 426, 619
BmrI	ACTGGG	1 cut(s)	806
BmsI	GCATC	2 cut(s)	231, 375
BmuI	ACTGGG	1 cut(s)	806
BpiI	GAAGAC	1 cut(s)	134
BpmI	CTGGAG	1 cut(s)	198
BpuEI	CTTGAG	1 cut(s)	568
BpuMI	CCSGG	1 cut(s)	258
BsaAI	YACGTR	1 cut(s)	363
BsaJI	CCNNGG	5 cut(s)	117, 257, 424, 617, 618
BsaXI	ACNNNNNCTCC	2 cut(s)	171, 201
Bsc4I	CCNNNNNNNGG	1 cut(s)	286
Bse1I	ACTGG	2 cut(s)	388, 812
Bse3DI	GCAATG	1 cut(s)	510
BseBI	CCWGG	4 cut(s)	85, 177, 426, 619
BseDI	CCNNGG	5 cut(s)	117, 257, 424, 617, 618
BseGI	GGATG	1 cut(s)	173
BseLI	CCNNNNNNNGG	1 cut(s)	286
BseMI	GCAATG	1 cut(s)	510
BseMII	CTCAG	1 cut(s)	108
BseNI	ACTGG	2 cut(s)	388, 812
BseXI	GCAGC	3 cut(s)	454, 517, 545
BsgI	GTGCAG	1 cut(s)	626
BshFI	GGCC	1 cut(s)	615
BshNI	GGYRCC	3 cut(s)	253, 276, 331
BsiSI	CCGG	1 cut(s)	257
BslFI	GGGAC	2 cut(s)	186, 406
BslI	CCNNNNNNNGG	1 cut(s)	286
BsmAI	GTCTC	1 cut(s)	162
BsmFI	GGGAC	2 cut(s)	186, 406
BsnI	GGCC	1 cut(s)	615
Bsp143I	GATC	4 cut(s)	25, 40, 405, 459
Bsp19I	CCATGG	1 cut(s)	117
BspACI	CCGC	1 cut(s)	114
BspANI	GGCC	1 cut(s)	615
BspCNI	CTCAG	1 cut(s)	107
BspHI	TCATGA	1 cut(s)	456
BspLI	GGNNCC	5 cut(s)	174, 255, 278, 333, 616
BspMAI	CTGCAG	2 cut(s)	402, 535
BspPI	GGATC	2 cut(s)	48, 400
BspT107I	GGYRCC	3 cut(s)	253, 276, 331
BsrDI	GCAATG	1 cut(s)	510
BsrI	ACTGG	2 cut(s)	388, 812
BssECI	CCNNGG	5 cut(s)	117, 257, 424, 617, 618
BssMI	GATC	4 cut(s)	25, 40, 405, 459
BssT1I	CCWWGG	1 cut(s)	117
Bst2UI	CCWGG	4 cut(s)	85, 177, 426, 619
Bst4CI	ACNGT	4 cut(s)	187, 418, 562, 848
Bst6I	CTCTTC	1 cut(s)	257
BstBAI	YACGTR	1 cut(s)	363
BstC8I	GCNNGC	1 cut(s)	780
BstDEI	CTNAG	2 cut(s)	94, 885
BstDSI	CCRYGG	1 cut(s)	117
BstF5I	GGATG	1 cut(s)	173
BstKTI	GATC	4 cut(s)	28, 43, 408, 462
BstMAI	GTCTC	1 cut(s)	162
BstMBI	GATC	4 cut(s)	25, 40, 405, 459
BstMWI	GCNNNNNNNGC	1 cut(s)	572
BstNI	CCWGG	4 cut(s)	85, 177, 426, 619
BstNSI	RCATGY	1 cut(s)	299
BstSCI	CCNGG	5 cut(s)	83, 175, 256, 424, 617
BstSFI	CTRYAG	3 cut(s)	398, 531, 558
BstV1I	GCAGC	3 cut(s)	454, 517, 545
BstV2I	GAAGAC	1 cut(s)	134
BstX2I	RGATCY	2 cut(s)	40, 405
BstYI	RGATCY	2 cut(s)	40, 405
BsuRI	GGCC	1 cut(s)	615
BtgI	CCRYGG	1 cut(s)	117
BtsCI	GGATG	1 cut(s)	173
BtsI	GCAGTG	1 cut(s)	395
BtsIMutI	CAGTG	2 cut(s)	395, 853
Cac8I	GCNNGC	1 cut(s)	780
CciI	TCATGA	1 cut(s)	456
Cfr13I	GGNCC	2 cut(s)	173, 614
CsiI	ACCWGGT	1 cut(s)	83
Csp6I	GTAC	4 cut(s)	91, 277, 332, 360
CviQI	GTAC	4 cut(s)	91, 277, 332, 360
DdeI	CTNAG	2 cut(s)	94, 885
DpnI	GATC	4 cut(s)	27, 42, 407, 461
DpnII	GATC	4 cut(s)	25, 40, 405, 459
DraIII	CACNNNGTG	1 cut(s)	700
Eam1104I	CTCTTC	1 cut(s)	257
EarI	CTCTTC	1 cut(s)	257
Eco130I	CCWWGG	1 cut(s)	117
Eco47I	GGWCC	1 cut(s)	173
EcoO109I	RGGNCCY	1 cut(s)	173
EcoRII	CCWGG	4 cut(s)	83, 175, 424, 617
EcoT14I	CCWWGG	1 cut(s)	117
EcoT22I	ATGCAT	1 cut(s)	246
ErhI	CCWWGG	1 cut(s)	117
FalI	AAGNNNNNCTT	2 cut(s)	708, 740
FaqI	GGGAC	2 cut(s)	186, 406
FauNDI	CATATG	1 cut(s)	784
FbaI	TGATCA	1 cut(s)	25
Fnu4HI	GCNGC	3 cut(s)	468, 531, 534
FokI	GGATG	1 cut(s)	180
Fsp4HI	GCNGC	3 cut(s)	468, 531, 534
FspBI	CTAG	3 cut(s)	72, 314, 498
GluI	GCNGC	3 cut(s)	468, 531, 534
GsuI	CTGGAG	1 cut(s)	198
HaeIII	GGCC	1 cut(s)	615
HapII	CCGG	1 cut(s)	257
HincII	GTYRAC	1 cut(s)	293
HindII	GTYRAC	1 cut(s)	293
HinfI	GANTC	3 cut(s)	248, 712, 950
HpaII	CCGG	1 cut(s)	257
HphI	GGTGA	3 cut(s)	103, 202, 482
Hpy166II	GTNNAC	2 cut(s)	293, 475
Hpy188I	TCNGA	4 cut(s)	30, 45, 305, 842
Hpy188III	TCNNGA	2 cut(s)	457, 854
Hpy8I	GTNNAC	2 cut(s)	293, 475
HpyAV	CCTTC	5 cut(s)	25, 310, 738, 756, 760
HpyCH4III	ACNGT	4 cut(s)	187, 418, 562, 848
HpyCH4IV	ACGT	1 cut(s)	362
HpyCH4V	TGCA	9 cut(s)	80, 244, 352, 366, 400, 533, 607, 782, 977
HpyF10VI	GCNNNNNNNGC	1 cut(s)	572
HpyF3I	CTNAG	2 cut(s)	94, 885
HpySE526I	ACGT	1 cut(s)	362
KpnI	GGTACC	2 cut(s)	280, 335
Ksp22I	TGATCA	1 cut(s)	25
Kzo9I	GATC	4 cut(s)	25, 40, 405, 459
LmnI	GCTCC	2 cut(s)	572, 936
Lsp1109I	GCAGC	3 cut(s)	454, 517, 545
LweI	GCATC	2 cut(s)	231, 375
MabI	ACCWGGT	1 cut(s)	83
MaeI	CTAG	3 cut(s)	72, 314, 498
MaeII	ACGT	1 cut(s)	362
MaeIII	GTNAC	3 cut(s)	109, 181, 692
MalI	GATC	4 cut(s)	27, 42, 407, 461
MboI	GATC	4 cut(s)	25, 40, 405, 459
MboII	GAAGA	4 cut(s)	134, 274, 415, 454
MflI	RGATCY	2 cut(s)	40, 405
MluCI	AATT	1 cut(s)	505
MlyI	GAGTC	2 cut(s)	257, 959
MnlI	CCTC	3 cut(s)	258, 503, 875
Mph1103I	ATGCAT	1 cut(s)	246
MslI	CAYNNNNRTG	1 cut(s)	116
MspA1I	CMGCKG	1 cut(s)	536
MspI	CCGG	1 cut(s)	257
MspR9I	CCNGG	5 cut(s)	85, 177, 258, 426, 619
MvaI	CCWGG	4 cut(s)	85, 177, 426, 619
MwoI	GCNNNNNNNGC	1 cut(s)	572
NciI	CCSGG	1 cut(s)	258
NcoI	CCATGG	1 cut(s)	117
NdeI	CATATG	1 cut(s)	784
NdeII	GATC	4 cut(s)	25, 40, 405, 459
NlaIV	GGNNCC	5 cut(s)	174, 255, 278, 333, 616
NmuCI	GTSAC	2 cut(s)	109, 692
NsiI	ATGCAT	1 cut(s)	246
NspI	RCATGY	1 cut(s)	299
PagI	TCATGA	1 cut(s)	456
PasI	CCCWGGG	1 cut(s)	618
PfeI	GAWTC	1 cut(s)	712
PflMI	CCANNNNNTGG	1 cut(s)	286
PkrI	GCNGC	3 cut(s)	469, 532, 535
PleI	GAGTC	2 cut(s)	256, 958
PpsI	GAGTC	2 cut(s)	256, 958
Ppu21I	YACGTR	1 cut(s)	363
PpuMI	RGGWCCY	1 cut(s)	173
Psp5II	RGGWCCY	1 cut(s)	173
Psp6I	CCWGG	4 cut(s)	83, 175, 424, 617
PspGI	CCWGG	4 cut(s)	83, 175, 424, 617
PspN4I	GGNNCC	5 cut(s)	174, 255, 278, 333, 616
PspPI	GGNCC	2 cut(s)	173, 614
PspPPI	RGGWCCY	1 cut(s)	173
PstI	CTGCAG	2 cut(s)	402, 535
PsuI	RGATCY	2 cut(s)	40, 405
PvuII	CAGCTG	1 cut(s)	536
RsaI	GTAC	4 cut(s)	92, 278, 333, 361
RsaNI	GTAC	4 cut(s)	91, 277, 332, 360
RseI	CAYNNNNRTG	1 cut(s)	116
SatI	GCNGC	3 cut(s)	468, 531, 534
Sau3AI	GATC	4 cut(s)	25, 40, 405, 459
Sau96I	GGNCC	2 cut(s)	173, 614
SchI	GAGTC	2 cut(s)	257, 959
ScrFI	CCNGG	5 cut(s)	85, 177, 258, 426, 619
SexAI	ACCWGGT	1 cut(s)	83
SfaNI	GCATC	2 cut(s)	231, 375
SfcI	CTRYAG	3 cut(s)	398, 531, 558
SinI	GGWCC	1 cut(s)	173
SmiMI	CAYNNNNRTG	1 cut(s)	116
SmlI	CTYRAG	1 cut(s)	547
SmoI	CTYRAG	1 cut(s)	547
Sse9I	AATT	1 cut(s)	505
SsiI	CCGC	1 cut(s)	114
SspI	AATATT	1 cut(s)	964
SspMI	CTAG	3 cut(s)	72, 314, 498
StyD4I	CCNGG	5 cut(s)	83, 175, 256, 424, 617
StyI	CCWWGG	1 cut(s)	117
TaaI	ACNGT	4 cut(s)	187, 418, 562, 848
TaiI	ACGT	1 cut(s)	365
TaqI	TCGA	1 cut(s)	626
TasI	AATT	1 cut(s)	505
TfiI	GAWTC	1 cut(s)	712
TscAI	CASTG	2 cut(s)	402, 853
TseFI	GTSAC	2 cut(s)	109, 692
TseI	GCWGC	3 cut(s)	467, 530, 533
Tsp45I	GTSAC	2 cut(s)	109, 692
TspDTI	ATGAA	3 cut(s)	189, 442, 914
TspRI	CASTG	2 cut(s)	402, 853
Van91I	CCANNNNNTGG	1 cut(s)	286
VpaK11BI	GGWCC	1 cut(s)	173
XceI	RCATGY	1 cut(s)	299
XspI	CTAG	3 cut(s)	72, 314, 498
Zsp2I	ATGCAT	1 cut(s)	246

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.