Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001657.1

Orthogroup ID

OG0002737

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1232

Gene Structure 1232 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001657.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 415 bp

agttcatgggtttgccgatcttgtgttgtttactgctggacttgaaggttatgctagaccacttgttgacagaatagacgtagagaacctgttcagttttaggctttgtcggccttcaacaaccagcacggaataccgtgagcatgtcaaggatctctctggcctatcaaaggatatgggccgaattgttattgttgacaacaaccctttcagtttcatgttgcaacctttgaatggaattccttgcattccattttctgctgggcaaatacatgacacacagcttttggatgttcttcttccactgctcaagcacctatcgctacagaaagacgtgagacctgcgctttatgagaggtttcacatgcccgaatggtttcaaaagcagggaatcccttcaactagttggaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004721 GO:0006464 GO:0006470 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0019538 GO:0036211 GO:0042578 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NIF

Protein Analysis

137

Amino Acids

15.64

Weight (kDa)

6.56

Isoelectric Point (pI)

23.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002737)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G55960
fragaria_vesca	FvH4_6g11400 FvH4_6g11400 FvH4_7g24520
malus_domestica	MD01G1153200.v1.1 MD04G1153700.v1.1 MD07G1222200.v1.1 MD12G1166900.v1.1
prunus_persica	Prupe.2G250400_v2.0.a1 Prupe.6G277800_v2.0.a1
pyrus_communis	pycom01g17080 pycom07g20080 pycom12g15890
rosa_chinensis	RchiOBHm_Chr1g0370271 RchiOBHm_Chr1g0370291 RchiOBHm_Chr3g0463021
rosa_laevigata	RLG00000024816 RLG00000027058 RLG00000027059 RLG00000027062
rosa_multiflora	Rmu_sc0000766.1_g000029 Rmu_sc0001657.1_g000001 Rmu_sc0006707.1_g000006 Rmu_sc0008124.1_g000028
rosa_roxburghii	Rroxscaffold_4G00286680 Rroxscaffold_4G00287340 Rroxscaffold_6G00417040
rosa_rugosa	Rorug01G0355600 Rorug03G0061100 Rorug03G0061200 Rorug03G0061200
rosa_samantha	Rh1AG363900 Rh1BG327000 Rh1BG327100 Rh1DG357400 Rh3AG118800 Rh3DG124700
rosa_wichuraiana	Rw1G032030 Rw3G010090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	350
AclWI	GGATC	1 cut(s)	160
AcsI	RAATTY	1 cut(s)	238
AfiI	CCNNNNNNNGG	2 cut(s)	170, 234
AgsI	TTSAA	5 cut(s)	45, 118, 233, 381, 400
AhlI	ACTAGT	1 cut(s)	402
AjiI	CACGTC	1 cut(s)	335
AluBI	AGCT	1 cut(s)	284
AluI	AGCT	1 cut(s)	284
Alw26I	GTCTC	1 cut(s)	332
AlwI	GGATC	1 cut(s)	160
AoxI	GGCC	3 cut(s)	111, 161, 179
ApoI	RAATTY	1 cut(s)	238
Asp700I	GAANNNNTTC	3 cut(s)	90, 376, 395
AspLEI	GCGC	1 cut(s)	347
AspS9I	GGNCC	1 cut(s)	179
BcoDI	GTCTC	1 cut(s)	332
BcuI	ACTAGT	1 cut(s)	402
BfaI	CTAG	2 cut(s)	55, 403
BfmI	CTRYAG	1 cut(s)	324
BfuAI	ACCTGC	1 cut(s)	350
BmgBI	CACGTC	1 cut(s)	335
BmgT120I	GGNCC	1 cut(s)	179
BpuEI	CTTGAG	1 cut(s)	294
BsaI	GGTCTC	1 cut(s)	332
Bsc4I	CCNNNNNNNGG	2 cut(s)	170, 234
BseGI	GGATG	1 cut(s)	296
BseLI	CCNNNNNNNGG	2 cut(s)	170, 234
BseYI	CCCAGC	1 cut(s)	261
BshFI	GGCC	3 cut(s)	113, 163, 181
BslI	CCNNNNNNNGG	2 cut(s)	170, 234
BsmAI	GTCTC	1 cut(s)	332
BsmI	GAATGC	1 cut(s)	247
BsnI	GGCC	3 cut(s)	113, 163, 181
Bso31I	GGTCTC	1 cut(s)	332
Bsp143I	GATC	2 cut(s)	17, 152
BspANI	GGCC	3 cut(s)	113, 163, 181
BspMI	ACCTGC	1 cut(s)	350
BspPI	GGATC	1 cut(s)	160
BspTNI	GGTCTC	1 cut(s)	332
BssMI	GATC	2 cut(s)	17, 152
Bst4CI	ACNGT	1 cut(s)	138
BstENI	CCTNNNNNAGG	1 cut(s)	168
BstF5I	GGATG	1 cut(s)	296
BstHHI	GCGC	1 cut(s)	347
BstKTI	GATC	2 cut(s)	20, 155
BstMAI	GTCTC	1 cut(s)	332
BstMBI	GATC	2 cut(s)	17, 152
BstMWI	GCNNNNNNNGC	2 cut(s)	110, 320
BstNSI	RCATGY	2 cut(s)	147, 368
BstSFI	CTRYAG	1 cut(s)	324
BstX2I	RGATCY	1 cut(s)	152
BstYI	RGATCY	1 cut(s)	152
BsuRI	GGCC	3 cut(s)	113, 163, 181
BtrI	CACGTC	1 cut(s)	335
BtsCI	GGATG	1 cut(s)	296
BtsI	GCAGTG	1 cut(s)	303
BtsIMutI	CAGTG	1 cut(s)	303
BveI	ACCTGC	1 cut(s)	350
CfoI	GCGC	1 cut(s)	347
Cfr13I	GGNCC	1 cut(s)	179
CviAII	CATG	5 cut(s)	6, 144, 218, 273, 365
CviJI	RGCY	5 cut(s)	104, 113, 163, 181, 284
CviKI_1	RGCY	5 cut(s)	104, 113, 163, 181, 284
DpnI	GATC	2 cut(s)	19, 154
DpnII	GATC	2 cut(s)	17, 152
Eco31I	GGTCTC	1 cut(s)	332
EcoNI	CCTNNNNNAGG	1 cut(s)	168
EcoRI	GAATTC	1 cut(s)	238
FaeI	CATG	5 cut(s)	9, 147, 221, 276, 368
FaiI	YATR	8 cut(s)	7, 52, 145, 177, 219, 274, 352, 366
FatI	CATG	5 cut(s)	5, 143, 217, 272, 364
FokI	GGATG	1 cut(s)	303
FspBI	CTAG	2 cut(s)	55, 403
GlaI	GCGC	1 cut(s)	346
GsaI	CCCAGC	1 cut(s)	265
HaeIII	GGCC	3 cut(s)	113, 163, 181
HhaI	GCGC	1 cut(s)	347
Hin1II	CATG	5 cut(s)	9, 147, 221, 276, 368
Hin6I	GCGC	1 cut(s)	345
HinP1I	GCGC	1 cut(s)	345
HincII	GTYRAC	2 cut(s)	68, 197
HindII	GTYRAC	2 cut(s)	68, 197
HinfI	GANTC	1 cut(s)	391
Hpy166II	GTNNAC	3 cut(s)	31, 68, 197
Hpy8I	GTNNAC	3 cut(s)	31, 68, 197
HpyAV	CCTTC	3 cut(s)	39, 124, 406
HpyCH4III	ACNGT	1 cut(s)	138
HpyCH4IV	ACGT	2 cut(s)	79, 334
HpyCH4V	TGCA	2 cut(s)	224, 247
HpyF10VI	GCNNNNNNNGC	2 cut(s)	110, 320
HpySE526I	ACGT	2 cut(s)	79, 334
Hsp92II	CATG	5 cut(s)	9, 147, 221, 276, 368
HspAI	GCGC	1 cut(s)	345
Kzo9I	GATC	2 cut(s)	17, 152
LpnPI	CCDG	7 cut(s)	22, 102, 137, 145, 247, 355, 372
MaeI	CTAG	2 cut(s)	55, 403
MaeII	ACGT	2 cut(s)	79, 334
MalI	GATC	2 cut(s)	19, 154
MboI	GATC	2 cut(s)	17, 152
MboII	GAAGA	2 cut(s)	288, 291
MflI	RGATCY	1 cut(s)	152
MluCI	AATT	2 cut(s)	184, 238
MmeI	TCCRAC	1 cut(s)	387
MnlI	CCTC	1 cut(s)	349
MroXI	GAANNNNTTC	3 cut(s)	90, 376, 395
Mva1269I	GAATGC	1 cut(s)	247
MwoI	GCNNNNNNNGC	2 cut(s)	110, 320
NdeII	GATC	2 cut(s)	17, 152
NlaIII	CATG	5 cut(s)	9, 147, 221, 276, 368
NspI	RCATGY	2 cut(s)	147, 368
PctI	GAATGC	1 cut(s)	247
PdmI	GAANNNNTTC	3 cut(s)	90, 376, 395
PfeI	GAWTC	1 cut(s)	391
PspFI	CCCAGC	1 cut(s)	261
PspPI	GGNCC	1 cut(s)	179
PsuI	RGATCY	1 cut(s)	152
Sau3AI	GATC	2 cut(s)	17, 152
Sau96I	GGNCC	1 cut(s)	179
SetI	ASST	9 cut(s)	50, 82, 91, 230, 286, 319, 337, 344, 360
SfcI	CTRYAG	1 cut(s)	324
SmlI	CTYRAG	1 cut(s)	309
SmoI	CTYRAG	1 cut(s)	309
SpeI	ACTAGT	1 cut(s)	402
Sse9I	AATT	2 cut(s)	184, 238
SspMI	CTAG	2 cut(s)	55, 403
TaaI	ACNGT	1 cut(s)	138
TaiI	ACGT	2 cut(s)	82, 337
TasI	AATT	2 cut(s)	184, 238
TfiI	GAWTC	1 cut(s)	391
TscAI	CASTG	1 cut(s)	310
TspDTI	ATGAA	1 cut(s)	206
TspGWI	ACGGA	1 cut(s)	144
TspRI	CASTG	1 cut(s)	310
XagI	CCTNNNNNAGG	1 cut(s)	168
XapI	RAATTY	1 cut(s)	238
XceI	RCATGY	2 cut(s)	147, 368
XmnI	GAANNNNTTC	3 cut(s)	90, 376, 395
XspI	CTAG	2 cut(s)	55, 403

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.