Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001768.1

Orthogroup ID

OG0003774

Physical Location & Seq

Genomic Coordinates Forward (+)

89366 .. 89800

Gene Structure 435 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001768.1_g000022.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 435 bp

atgggcttatctgggttcttcttgattagtatgctccactctgttatatgtcttgtaagtggagctttcatgatgttctactccaatgaattctctgtgttcaaccatggccttgagacagcaagcaagcttcgagggtcaacgcctcatgatcaactcttgattctaacctcgaattccttctcgggttggcttctgtttgccattggattccttctgttcatggtggcttttgtcaaggactctaaattccagagcttctttgctaaagggtgtgtgttgcttcacatatccatggctatttggagagtttactttgggagggaactcgaagaccttgccagagattggcctaagcaggtcctcggagacatcacgttggcgctttcctggggttttcttcttatgtattcatggagggagaagtatgattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

144

Amino Acids

16.51

Weight (kDa)

6.9

Isoelectric Point (pI)

26.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003774)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G53035 AT1G53035 AT3G15358
fragaria_vesca	FvH4_3g09111 FvH4_3g09112 FvH4_3g19950
malus_domestica	MD02G1012100.v1.1 MD03G1227700.v1.1 MD10G1293900.v1.1 MD11G1247000.v1.1
prunus_persica	Prupe.4G047900_v2.0.a1 Prupe.4G047900_v2.0.a1 Prupe.4G181300_v2.0.a1
pyrus_communis	pycom05g29020
rosa_chinensis	RchiOBHm_Chr5g0008521 RchiOBHm_Chr5g0033631
rosa_laevigata	RLG00000031577 RLG00000033495
rosa_multiflora	Rmu_sc0001768.1_g000022
rosa_roxburghii	Rroxscaffold_1G00046450 Rroxscaffold_1G00068030
rosa_rugosa	Rorug04G0436600 Rorug05G0141500
rosa_samantha	Rh5AG065100 Rh5AG232400 Rh5BG062600 Rh5BG233100 Rh5CG072500 Rh5CG262000 Rh5DG063600 Rh5DG238700
rosa_wichuraiana	Rw5G005570 Rw5G021210 Rw5G021620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	349
AccB7I	CCANNNNNTGG	1 cut(s)	348
AcsI	RAATTY	3 cut(s)	89, 175, 248
AfiI	CCNNNNNNNGG	1 cut(s)	348
AgsI	TTSAA	1 cut(s)	103
AjnI	CCWGG	1 cut(s)	389
AluBI	AGCT	3 cut(s)	65, 130, 258
AluI	AGCT	3 cut(s)	65, 130, 258
Alw26I	GTCTC	2 cut(s)	110, 363
Ama87I	CYCGRG	1 cut(s)	184
AoxI	GGCC	2 cut(s)	109, 350
ApoI	RAATTY	3 cut(s)	89, 175, 248
Asp700I	GAANNNNTTC	1 cut(s)	179
AspLEI	GCGC	1 cut(s)	385
AspS9I	GGNCC	1 cut(s)	361
AvaI	CYCGRG	1 cut(s)	184
AvaII	GGWCC	1 cut(s)	361
BbsI	GAAGAC	1 cut(s)	339
BcgI	CGANNNNNNTGC	2 cut(s)	320, 354
BciT130I	CCWGG	1 cut(s)	391
BclI	TGATCA	1 cut(s)	151
BcoDI	GTCTC	2 cut(s)	110, 363
BfoI	RGCGCY	1 cut(s)	386
BfuAI	ACCTGC	1 cut(s)	349
Bme1390I	CCNGG	1 cut(s)	391
Bme18I	GGWCC	1 cut(s)	361
BmeT110I	CYCGRG	1 cut(s)	184
BmgT120I	GGNCC	1 cut(s)	361
BmrFI	CCNGG	1 cut(s)	391
BpiI	GAAGAC	1 cut(s)	339
Bpu10I	CCTNAGC	1 cut(s)	354
BpuEI	CTTGAG	1 cut(s)	134
BsaJI	CCNNGG	4 cut(s)	106, 294, 364, 390
Bsc4I	CCNNNNNNNGG	1 cut(s)	348
BseBI	CCWGG	1 cut(s)	391
BseDI	CCNNGG	4 cut(s)	106, 294, 364, 390
BseLI	CCNNNNNNNGG	1 cut(s)	348
BshFI	GGCC	2 cut(s)	111, 352
BsiHKCI	CYCGRG	1 cut(s)	184
BslI	CCNNNNNNNGG	1 cut(s)	348
BsmAI	GTCTC	2 cut(s)	110, 363
BsnI	GGCC	2 cut(s)	111, 352
BsoBI	CYCGRG	1 cut(s)	184
Bsp143I	GATC	1 cut(s)	151
Bsp19I	CCATGG	2 cut(s)	106, 294
BspANI	GGCC	2 cut(s)	111, 352
BspHI	TCATGA	2 cut(s)	69, 148
BspMI	ACCTGC	1 cut(s)	349
BssECI	CCNNGG	4 cut(s)	106, 294, 364, 390
BssMI	GATC	1 cut(s)	151
BssT1I	CCWWGG	2 cut(s)	106, 294
Bst2UI	CCWGG	1 cut(s)	391
BstC8I	GCNNGC	2 cut(s)	124, 128
BstDEI	CTNAG	1 cut(s)	354
BstDSI	CCRYGG	2 cut(s)	106, 294
BstH2I	RGCGCY	1 cut(s)	386
BstHHI	GCGC	1 cut(s)	385
BstKTI	GATC	1 cut(s)	154
BstMAI	GTCTC	2 cut(s)	110, 363
BstMBI	GATC	1 cut(s)	151
BstNI	CCWGG	1 cut(s)	391
BstSCI	CCNGG	1 cut(s)	389
BstV2I	GAAGAC	1 cut(s)	339
BsuRI	GGCC	2 cut(s)	111, 352
BtgI	CCRYGG	2 cut(s)	106, 294
BveI	ACCTGC	1 cut(s)	349
Cac8I	GCNNGC	2 cut(s)	124, 128
CciI	TCATGA	2 cut(s)	69, 148
CfoI	GCGC	1 cut(s)	385
Cfr13I	GGNCC	1 cut(s)	361
CviAII	CATG	6 cut(s)	70, 107, 149, 223, 295, 414
CviJI	RGCY	9 cut(s)	6, 65, 111, 130, 193, 230, 258, 299, 352
CviKI_1	RGCY	9 cut(s)	6, 65, 111, 130, 193, 230, 258, 299, 352
DdeI	CTNAG	1 cut(s)	354
DpnI	GATC	1 cut(s)	153
DpnII	GATC	1 cut(s)	151
Eco130I	CCWWGG	2 cut(s)	106, 294
Eco47I	GGWCC	1 cut(s)	361
Eco88I	CYCGRG	1 cut(s)	184
EcoO109I	RGGNCCY	1 cut(s)	361
EcoRI	GAATTC	2 cut(s)	89, 175
EcoRII	CCWGG	1 cut(s)	389
EcoT14I	CCWWGG	2 cut(s)	106, 294
ErhI	CCWWGG	2 cut(s)	106, 294
FaeI	CATG	6 cut(s)	73, 110, 152, 226, 298, 417
FalI	AAGNNNNNCTT	2 cut(s)	49, 81
FatI	CATG	6 cut(s)	69, 106, 148, 222, 294, 413
FbaI	TGATCA	1 cut(s)	151
GlaI	GCGC	1 cut(s)	384
HaeII	RGCGCY	1 cut(s)	386
HaeIII	GGCC	2 cut(s)	111, 352
HhaI	GCGC	1 cut(s)	385
Hin1II	CATG	6 cut(s)	73, 110, 152, 226, 298, 417
Hin6I	GCGC	1 cut(s)	383
HinP1I	GCGC	1 cut(s)	383
HincII	GTYRAC	1 cut(s)	141
HindII	GTYRAC	1 cut(s)	141
HindIII	AAGCTT	1 cut(s)	128
HinfI	GANTC	3 cut(s)	163, 210, 242
Hpy166II	GTNNAC	2 cut(s)	141, 313
Hpy188I	TCNGA	1 cut(s)	368
Hpy188III	TCNNGA	5 cut(s)	22, 70, 149, 160, 253
Hpy8I	GTNNAC	2 cut(s)	141, 313
HpyAV	CCTTC	2 cut(s)	190, 224
HpyCH4IV	ACGT	1 cut(s)	377
HpyF3I	CTNAG	1 cut(s)	354
HpySE526I	ACGT	1 cut(s)	377
Hsp92II	CATG	6 cut(s)	73, 110, 152, 226, 298, 417
HspAI	GCGC	1 cut(s)	383
Ksp22I	TGATCA	1 cut(s)	151
Kzo9I	GATC	1 cut(s)	151
LmnI	GCTCC	2 cut(s)	39, 62
LpnPI	CCDG	5 cut(s)	266, 344, 355, 376, 403
MaeII	ACGT	1 cut(s)	377
MalI	GATC	1 cut(s)	153
MboI	GATC	1 cut(s)	151
MboII	GAAGA	3 cut(s)	10, 344, 392
MluCI	AATT	3 cut(s)	89, 175, 248
MlyI	GAGTC	1 cut(s)	236
MnlI	CCTC	6 cut(s)	128, 156, 181, 315, 374, 411
MroXI	GAANNNNTTC	1 cut(s)	179
MslI	CAYNNNNRTG	1 cut(s)	293
MspR9I	CCNGG	1 cut(s)	391
MvaI	CCWGG	1 cut(s)	391
NcoI	CCATGG	2 cut(s)	106, 294
NdeII	GATC	1 cut(s)	151
NlaIII	CATG	6 cut(s)	73, 110, 152, 226, 298, 417
PagI	TCATGA	2 cut(s)	69, 148
PdmI	GAANNNNTTC	1 cut(s)	179
PfeI	GAWTC	2 cut(s)	163, 210
PflMI	CCANNNNNTGG	1 cut(s)	348
PleI	GAGTC	1 cut(s)	236
PpsI	GAGTC	1 cut(s)	236
PpuMI	RGGWCCY	1 cut(s)	361
Psp5II	RGGWCCY	1 cut(s)	361
Psp6I	CCWGG	1 cut(s)	389
PspGI	CCWGG	1 cut(s)	389
PspPI	GGNCC	1 cut(s)	361
PspPPI	RGGWCCY	1 cut(s)	361
RseI	CAYNNNNRTG	1 cut(s)	293
Sau3AI	GATC	1 cut(s)	151
Sau96I	GGNCC	1 cut(s)	361
SchI	GAGTC	1 cut(s)	236
ScrFI	CCNGG	1 cut(s)	391
SetI	ASST	7 cut(s)	67, 132, 173, 260, 339, 363, 380
SinI	GGWCC	1 cut(s)	361
SmiMI	CAYNNNNRTG	1 cut(s)	293
SmlI	CTYRAG	1 cut(s)	113
SmoI	CTYRAG	1 cut(s)	113
Sse9I	AATT	3 cut(s)	89, 175, 248
StyD4I	CCNGG	1 cut(s)	389
StyI	CCWWGG	2 cut(s)	106, 294
TaiI	ACGT	1 cut(s)	380
TaqI	TCGA	3 cut(s)	133, 173, 330
TasI	AATT	3 cut(s)	89, 175, 248
TfiI	GAWTC	2 cut(s)	163, 210
TspDTI	ATGAA	4 cut(s)	58, 102, 211, 402
Van91I	CCANNNNNTGG	1 cut(s)	348
VpaK11BI	GGWCC	1 cut(s)	361
XapI	RAATTY	3 cut(s)	89, 175, 248
XmnI	GAANNNNTTC	1 cut(s)	179

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.