Rmu_sc0001768.1_g000022

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001768.1
Physical Location & Seq
Forward (+)
89366 .. 89800
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001768.1_g000022.1.cds

Sequence Viewer

Length: 435 bp
atgggcttatctgggttcttcttgattagtatgctccactctgttatatgtcttgtaagtggagctttcatgatgttctactccaatgaattctctgtgttcaaccatggccttgagacagcaagcaagcttcgagggtcaacgcctcatgatcaactcttgattctaacctcgaattccttctcgggttggcttctgtttgccattggattccttctgttcatggtggcttttgtcaaggactctaaattccagagcttctttgctaaagggtgtgtgttgcttcacatatccatggctatttggagagtttactttgggagggaactcgaagaccttgccagagattggcctaagcaggtcctcggagacatcacgttggcgctttcctggggttttcttcttatgtattcatggagggagaagtatgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

144

Amino Acids

16.51

Weight (kDa)

6.9

Isoelectric Point (pI)

26.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 349
AccB7I CCANNNNNTGG 1 cut(s) 348
AcsI RAATTY 3 cut(s) 89, 175, 248
AfiI CCNNNNNNNGG 1 cut(s) 348
AgsI TTSAA 1 cut(s) 103
AjnI CCWGG 1 cut(s) 389
AluBI AGCT 3 cut(s) 65, 130, 258
AluI AGCT 3 cut(s) 65, 130, 258
Alw26I GTCTC 2 cut(s) 110, 363
Ama87I CYCGRG 1 cut(s) 184
AoxI GGCC 2 cut(s) 109, 350
ApoI RAATTY 3 cut(s) 89, 175, 248
Asp700I GAANNNNTTC 1 cut(s) 179
AspLEI GCGC 1 cut(s) 385
AspS9I GGNCC 1 cut(s) 361
AvaI CYCGRG 1 cut(s) 184
AvaII GGWCC 1 cut(s) 361
BbsI GAAGAC 1 cut(s) 339
BcgI CGANNNNNNTGC 2 cut(s) 320, 354
BciT130I CCWGG 1 cut(s) 391
BclI TGATCA 1 cut(s) 151
BcoDI GTCTC 2 cut(s) 110, 363
BfoI RGCGCY 1 cut(s) 386
BfuAI ACCTGC 1 cut(s) 349
Bme1390I CCNGG 1 cut(s) 391
Bme18I GGWCC 1 cut(s) 361
BmeT110I CYCGRG 1 cut(s) 184
BmgT120I GGNCC 1 cut(s) 361
BmrFI CCNGG 1 cut(s) 391
BpiI GAAGAC 1 cut(s) 339
Bpu10I CCTNAGC 1 cut(s) 354
BpuEI CTTGAG 1 cut(s) 134
BsaJI CCNNGG 4 cut(s) 106, 294, 364, 390
Bsc4I CCNNNNNNNGG 1 cut(s) 348
BseBI CCWGG 1 cut(s) 391
BseDI CCNNGG 4 cut(s) 106, 294, 364, 390
BseLI CCNNNNNNNGG 1 cut(s) 348
BshFI GGCC 2 cut(s) 111, 352
BsiHKCI CYCGRG 1 cut(s) 184
BslI CCNNNNNNNGG 1 cut(s) 348
BsmAI GTCTC 2 cut(s) 110, 363
BsnI GGCC 2 cut(s) 111, 352
BsoBI CYCGRG 1 cut(s) 184
Bsp143I GATC 1 cut(s) 151
Bsp19I CCATGG 2 cut(s) 106, 294
BspANI GGCC 2 cut(s) 111, 352
BspHI TCATGA 2 cut(s) 69, 148
BspMI ACCTGC 1 cut(s) 349
BssECI CCNNGG 4 cut(s) 106, 294, 364, 390
BssMI GATC 1 cut(s) 151
BssT1I CCWWGG 2 cut(s) 106, 294
Bst2UI CCWGG 1 cut(s) 391
BstC8I GCNNGC 2 cut(s) 124, 128
BstDEI CTNAG 1 cut(s) 354
BstDSI CCRYGG 2 cut(s) 106, 294
BstH2I RGCGCY 1 cut(s) 386
BstHHI GCGC 1 cut(s) 385
BstKTI GATC 1 cut(s) 154
BstMAI GTCTC 2 cut(s) 110, 363
BstMBI GATC 1 cut(s) 151
BstNI CCWGG 1 cut(s) 391
BstSCI CCNGG 1 cut(s) 389
BstV2I GAAGAC 1 cut(s) 339
BsuRI GGCC 2 cut(s) 111, 352
BtgI CCRYGG 2 cut(s) 106, 294
BveI ACCTGC 1 cut(s) 349
Cac8I GCNNGC 2 cut(s) 124, 128
CciI TCATGA 2 cut(s) 69, 148
CfoI GCGC 1 cut(s) 385
Cfr13I GGNCC 1 cut(s) 361
CviAII CATG 6 cut(s) 70, 107, 149, 223, 295, 414
CviJI RGCY 9 cut(s) 6, 65, 111, 130, 193, 230, 258, 299, 352
CviKI_1 RGCY 9 cut(s) 6, 65, 111, 130, 193, 230, 258, 299, 352
DdeI CTNAG 1 cut(s) 354
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
Eco130I CCWWGG 2 cut(s) 106, 294
Eco47I GGWCC 1 cut(s) 361
Eco88I CYCGRG 1 cut(s) 184
EcoO109I RGGNCCY 1 cut(s) 361
EcoRI GAATTC 2 cut(s) 89, 175
EcoRII CCWGG 1 cut(s) 389
EcoT14I CCWWGG 2 cut(s) 106, 294
ErhI CCWWGG 2 cut(s) 106, 294
FaeI CATG 6 cut(s) 73, 110, 152, 226, 298, 417
FalI AAGNNNNNCTT 2 cut(s) 49, 81
FatI CATG 6 cut(s) 69, 106, 148, 222, 294, 413
FbaI TGATCA 1 cut(s) 151
GlaI GCGC 1 cut(s) 384
HaeII RGCGCY 1 cut(s) 386
HaeIII GGCC 2 cut(s) 111, 352
HhaI GCGC 1 cut(s) 385
Hin1II CATG 6 cut(s) 73, 110, 152, 226, 298, 417
Hin6I GCGC 1 cut(s) 383
HinP1I GCGC 1 cut(s) 383
HincII GTYRAC 1 cut(s) 141
HindII GTYRAC 1 cut(s) 141
HindIII AAGCTT 1 cut(s) 128
HinfI GANTC 3 cut(s) 163, 210, 242
Hpy166II GTNNAC 2 cut(s) 141, 313
Hpy188I TCNGA 1 cut(s) 368
Hpy188III TCNNGA 5 cut(s) 22, 70, 149, 160, 253
Hpy8I GTNNAC 2 cut(s) 141, 313
HpyAV CCTTC 2 cut(s) 190, 224
HpyCH4IV ACGT 1 cut(s) 377
HpyF3I CTNAG 1 cut(s) 354
HpySE526I ACGT 1 cut(s) 377
Hsp92II CATG 6 cut(s) 73, 110, 152, 226, 298, 417
HspAI GCGC 1 cut(s) 383
Ksp22I TGATCA 1 cut(s) 151
Kzo9I GATC 1 cut(s) 151
LmnI GCTCC 2 cut(s) 39, 62
LpnPI CCDG 5 cut(s) 266, 344, 355, 376, 403
MaeII ACGT 1 cut(s) 377
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 3 cut(s) 10, 344, 392
MluCI AATT 3 cut(s) 89, 175, 248
MlyI GAGTC 1 cut(s) 236
MnlI CCTC 6 cut(s) 128, 156, 181, 315, 374, 411
MroXI GAANNNNTTC 1 cut(s) 179
MslI CAYNNNNRTG 1 cut(s) 293
MspR9I CCNGG 1 cut(s) 391
MvaI CCWGG 1 cut(s) 391
NcoI CCATGG 2 cut(s) 106, 294
NdeII GATC 1 cut(s) 151
NlaIII CATG 6 cut(s) 73, 110, 152, 226, 298, 417
PagI TCATGA 2 cut(s) 69, 148
PdmI GAANNNNTTC 1 cut(s) 179
PfeI GAWTC 2 cut(s) 163, 210
PflMI CCANNNNNTGG 1 cut(s) 348
PleI GAGTC 1 cut(s) 236
PpsI GAGTC 1 cut(s) 236
PpuMI RGGWCCY 1 cut(s) 361
Psp5II RGGWCCY 1 cut(s) 361
Psp6I CCWGG 1 cut(s) 389
PspGI CCWGG 1 cut(s) 389
PspPI GGNCC 1 cut(s) 361
PspPPI RGGWCCY 1 cut(s) 361
RseI CAYNNNNRTG 1 cut(s) 293
Sau3AI GATC 1 cut(s) 151
Sau96I GGNCC 1 cut(s) 361
SchI GAGTC 1 cut(s) 236
ScrFI CCNGG 1 cut(s) 391
SetI ASST 7 cut(s) 67, 132, 173, 260, 339, 363, 380
SinI GGWCC 1 cut(s) 361
SmiMI CAYNNNNRTG 1 cut(s) 293
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
Sse9I AATT 3 cut(s) 89, 175, 248
StyD4I CCNGG 1 cut(s) 389
StyI CCWWGG 2 cut(s) 106, 294
TaiI ACGT 1 cut(s) 380
TaqI TCGA 3 cut(s) 133, 173, 330
TasI AATT 3 cut(s) 89, 175, 248
TfiI GAWTC 2 cut(s) 163, 210
TspDTI ATGAA 4 cut(s) 58, 102, 211, 402
Van91I CCANNNNNTGG 1 cut(s) 348
VpaK11BI GGWCC 1 cut(s) 361
XapI RAATTY 3 cut(s) 89, 175, 248
XmnI GAANNNNTTC 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.