Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002064.1

Orthogroup ID

OG0011871

Physical Location & Seq

Genomic Coordinates Reverse (-)

34507 .. 36061

Gene Structure 1555 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002064.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 708 bp

atgggttctcttcaggttttcatttctgcagcagcattactagttctggttttggcagccattgatgaagctcaagcaaataccgtggtcagtggcacagtcttctgtgaccaatgcaaagatggtgaaaggtccctctttgattatccaatctatggaattaaagtacaagtggcatgtagtgacagtaatggccaagtgacaatgtcaagggaggagactaccaattggtttgggaactatgctatgcaatttgatgggacaccagatttgagcggctgttatgccaaggctttaagctcagggcaaggctcatgtgggattccccttccctgtaggccttgccacaatgttaggagttggacaaggccagagtacaaatgctactggagggcagtgaatccagacacaaaggtagctgttgttttcggattgcttgcagcaagaagatatgggactgacctaacattgtggcaaggcctacagggaagaggagacccttataggactctcctaagggaaggcatcactgcctttctcaactcctacaacagtcttcaatttccttacaataccattgctgttgtgcagcatatgaattctggattgatgggttccgagaggaatgtcctctatacagccttgaggttcatcagggctaattcaggctatggcaaagtcacctgcaaatttacttcttgcaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pollen_Ole_e_I

Protein Analysis

235

Amino Acids

25.87

Weight (kDa)

8.66

Isoelectric Point (pI)

28.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011871)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G16630
fragaria_vesca	FvH4_2g01740
malus_domestica	MD05G1116900.v1.1 MD10G1120000.v1.1 MD10G1120100.v1.1
prunus_persica	Prupe.8G161400_v2.0.a1 Prupe.8G161400_v2.0.a1
pyrus_communis	pycom05g11120 pycom10g10340
rosa_chinensis	RchiOBHm_Chr6g0244771
rosa_laevigata	RLG00000015330
rosa_multiflora	Rmu_sc0002064.1_g000006 Rmu_sc0009252.1_g000008 Rmu_sc0012997.1_g000003
rosa_roxburghii	Rroxscaffold_7G00215510
rosa_rugosa	Rorug05G0510500
rosa_samantha	Rh6AG025700 Rh6BG021400
rosa_wichuraiana	Rw6G002170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	692
Acc36I	ACCTGC	1 cut(s)	692
AccB7I	CCANNNNNTGG	1 cut(s)	155
AccBSI	CCGCTC	1 cut(s)	276
AciI	CCGC	1 cut(s)	276
AcoI	YGGCCR	1 cut(s)	193
AcsI	RAATTY	2 cut(s)	598, 689
AfaI	GTAC	2 cut(s)	168, 377
AfiI	CCNNNNNNNGG	1 cut(s)	155
AgsI	TTSAA	1 cut(s)	560
AhlI	ACTAGT	1 cut(s)	40
AluBI	AGCT	3 cut(s)	71, 300, 419
AluI	AGCT	3 cut(s)	71, 300, 419
Alw26I	GTCTC	2 cut(s)	212, 489
AoxI	GGCC	4 cut(s)	193, 338, 368, 478
ApeKI	GCWGC	5 cut(s)	29, 32, 56, 440, 589
ApoI	RAATTY	2 cut(s)	598, 689
ArsI	GACNNNNNNTTYG	2 cut(s)	253, 285
AspS9I	GGNCC	1 cut(s)	132
AsuHPI	GGTGA	2 cut(s)	137, 673
AvaII	GGWCC	1 cut(s)	132
AxyI	CCTNAGG	1 cut(s)	515
BalI	TGGCCA	1 cut(s)	195
BbsI	GAAGAC	2 cut(s)	94, 548
BbvI	GCAGC	5 cut(s)	41, 44, 68, 452, 601
BccI	CCATC	3 cut(s)	116, 251, 604
BcoDI	GTCTC	2 cut(s)	212, 489
BcuI	ACTAGT	1 cut(s)	40
BfaI	CTAG	1 cut(s)	41
BfmI	CTRYAG	3 cut(s)	27, 334, 482
BfuAI	ACCTGC	1 cut(s)	692
BisI	GCNGC	6 cut(s)	30, 33, 57, 277, 441, 590
BlsI	GCNGC	6 cut(s)	31, 34, 58, 278, 442, 591
Bme18I	GGWCC	1 cut(s)	132
BmgT120I	GGNCC	1 cut(s)	132
BmiI	GGNNCC	2 cut(s)	134, 616
BmsI	GCATC	1 cut(s)	534
BpiI	GAAGAC	2 cut(s)	94, 548
BpmI	CTGGAG	1 cut(s)	409
Bpu10I	CCTNAGC	1 cut(s)	301
BpuEI	CTTGAG	2 cut(s)	57, 664
BsaI	GGTCTC	1 cut(s)	489
BsaJI	CCNNGG	2 cut(s)	84, 288
Bsc4I	CCNNNNNNNGG	1 cut(s)	155
Bse1I	ACTGG	1 cut(s)	392
Bse21I	CCTNAGG	1 cut(s)	515
Bse3DI	GCAATG	1 cut(s)	576
BseDI	CCNNGG	2 cut(s)	84, 288
BseLI	CCNNNNNNNGG	1 cut(s)	155
BseMI	GCAATG	1 cut(s)	576
BseMII	CTCAG	1 cut(s)	315
BseNI	ACTGG	1 cut(s)	392
BseRI	GAGGAG	2 cut(s)	230, 507
BseXI	GCAGC	5 cut(s)	41, 44, 68, 452, 601
BsgI	GTGCAG	1 cut(s)	608
BshFI	GGCC	4 cut(s)	195, 340, 370, 480
BslFI	GGGAC	3 cut(s)	118, 274, 469
BslI	CCNNNNNNNGG	1 cut(s)	155
BsmAI	GTCTC	2 cut(s)	212, 489
BsmFI	GGGAC	3 cut(s)	118, 274, 469
BsnI	GGCC	4 cut(s)	195, 340, 370, 480
Bso31I	GGTCTC	1 cut(s)	489
BspACI	CCGC	1 cut(s)	276
BspANI	GGCC	4 cut(s)	195, 340, 370, 480
BspCNI	CTCAG	1 cut(s)	314
BspLI	GGNNCC	2 cut(s)	134, 616
BspMAI	CTGCAG	1 cut(s)	31
BspMI	ACCTGC	1 cut(s)	692
BspTNI	GGTCTC	1 cut(s)	489
BsrBI	CCGCTC	1 cut(s)	276
BsrDI	GCAATG	1 cut(s)	576
BsrI	ACTGG	1 cut(s)	392
BssECI	CCNNGG	2 cut(s)	84, 288
BssT1I	CCWWGG	1 cut(s)	288
Bst4CI	ACNGT	4 cut(s)	85, 100, 188, 554
Bst6I	CTCTTC	2 cut(s)	15, 484
BstC8I	GCNNGC	1 cut(s)	438
BstDEI	CTNAG	2 cut(s)	301, 515
BstDSI	CCRYGG	1 cut(s)	84
BstMAI	GTCTC	2 cut(s)	212, 489
BstNSI	RCATGY	1 cut(s)	180
BstSFI	CTRYAG	3 cut(s)	27, 334, 482
BstV1I	GCAGC	5 cut(s)	41, 44, 68, 452, 601
BstV2I	GAAGAC	2 cut(s)	94, 548
Bsu36I	CCTNAGG	1 cut(s)	515
BsuRI	GGCC	4 cut(s)	195, 340, 370, 480
BtgI	CCRYGG	1 cut(s)	84
BtsI	GCAGTG	2 cut(s)	402, 528
BtsIMutI	CAGTG	3 cut(s)	97, 402, 528
BveI	ACCTGC	1 cut(s)	692
Cac8I	GCNNGC	1 cut(s)	438
Cfr13I	GGNCC	1 cut(s)	132
Csp6I	GTAC	2 cut(s)	167, 376
CspCI	CAANNNNNGTGG	2 cut(s)	66, 101
CviAII	CATG	2 cut(s)	177, 315
CviQI	GTAC	2 cut(s)	167, 376
DdeI	CTNAG	2 cut(s)	301, 515
EaeI	YGGCCR	1 cut(s)	193
Eam1104I	CTCTTC	2 cut(s)	15, 484
EarI	CTCTTC	2 cut(s)	15, 484
Eco130I	CCWWGG	1 cut(s)	288
Eco147I	AGGCCT	2 cut(s)	340, 480
Eco31I	GGTCTC	1 cut(s)	489
Eco47I	GGWCC	1 cut(s)	132
Eco81I	CCTNAGG	1 cut(s)	515
EcoO109I	RGGNCCY	1 cut(s)	132
EcoRI	GAATTC	1 cut(s)	598
EcoT14I	CCWWGG	1 cut(s)	288
ErhI	CCWWGG	1 cut(s)	288
FaeI	CATG	2 cut(s)	180, 318
FaqI	GGGAC	3 cut(s)	118, 274, 469
FatI	CATG	2 cut(s)	176, 314
FauNDI	CATATG	1 cut(s)	594
Fnu4HI	GCNGC	6 cut(s)	30, 33, 57, 277, 441, 590
Fsp4HI	GCNGC	6 cut(s)	30, 33, 57, 277, 441, 590
FspBI	CTAG	1 cut(s)	41
GluI	GCNGC	6 cut(s)	30, 33, 57, 277, 441, 590
GsuI	CTGGAG	1 cut(s)	409
HaeIII	GGCC	4 cut(s)	195, 340, 370, 480
Hin1II	CATG	2 cut(s)	180, 318
HinfI	GANTC	3 cut(s)	322, 400, 508
HphI	GGTGA	2 cut(s)	137, 673
Hpy188I	TCNGA	2 cut(s)	431, 619
Hpy188III	TCNNGA	2 cut(s)	404, 603
HpyAV	CCTTC	2 cut(s)	338, 515
HpyCH4III	ACNGT	4 cut(s)	85, 100, 188, 554
HpyCH4V	TGCA	7 cut(s)	29, 117, 250, 440, 589, 687, 702
HpyF3I	CTNAG	2 cut(s)	301, 515
Hsp92II	CATG	2 cut(s)	180, 318
Lsp1109I	GCAGC	5 cut(s)	41, 44, 68, 452, 601
LweI	GCATC	1 cut(s)	534
MaeI	CTAG	1 cut(s)	41
MaeIII	GTNAC	4 cut(s)	107, 182, 199, 679
MbiI	CCGCTC	1 cut(s)	276
MboII	GAAGA	4 cut(s)	94, 459, 501, 548
MfeI	CAATTG	1 cut(s)	226
MlsI	TGGCCA	1 cut(s)	195
MluCI	AATT	7 cut(s)	159, 226, 251, 560, 598, 661, 689
MluNI	TGGCCA	1 cut(s)	195
MlyI	GAGTC	1 cut(s)	502
MmeI	TCCRAC	1 cut(s)	341
MnlI	CCTC	7 cut(s)	146, 208, 384, 485, 615, 639, 641
Mox20I	TGGCCA	1 cut(s)	195
MscI	TGGCCA	1 cut(s)	195
MseI	TTAA	2 cut(s)	162, 296
Msp20I	TGGCCA	1 cut(s)	195
MunI	CAATTG	1 cut(s)	226
NdeI	CATATG	1 cut(s)	594
NlaIII	CATG	2 cut(s)	180, 318
NlaIV	GGNNCC	2 cut(s)	134, 616
NmuCI	GTSAC	4 cut(s)	107, 182, 199, 679
NspI	RCATGY	1 cut(s)	180
PaqCI	CACCTGC	1 cut(s)	692
PceI	AGGCCT	2 cut(s)	340, 480
PfeI	GAWTC	2 cut(s)	322, 400
PflFI	GACNNNGTC	1 cut(s)	205
PflMI	CCANNNNNTGG	1 cut(s)	155
PkrI	GCNGC	6 cut(s)	31, 34, 58, 278, 442, 591
PleI	GAGTC	1 cut(s)	502
PpsI	GAGTC	1 cut(s)	502
PpuMI	RGGWCCY	1 cut(s)	132
Psp5II	RGGWCCY	1 cut(s)	132
PspN4I	GGNNCC	2 cut(s)	134, 616
PspPI	GGNCC	1 cut(s)	132
PspPPI	RGGWCCY	1 cut(s)	132
PstI	CTGCAG	1 cut(s)	31
PsyI	GACNNNGTC	1 cut(s)	205
RsaI	GTAC	2 cut(s)	168, 377
RsaNI	GTAC	2 cut(s)	167, 376
SaqAI	TTAA	2 cut(s)	162, 296
SatI	GCNGC	6 cut(s)	30, 33, 57, 277, 441, 590
Sau96I	GGNCC	1 cut(s)	132
SchI	GAGTC	1 cut(s)	502
SetI	ASST	9 cut(s)	18, 73, 134, 302, 417, 421, 465, 650, 686
SfaNI	GCATC	1 cut(s)	534
SfcI	CTRYAG	3 cut(s)	27, 334, 482
SinI	GGWCC	1 cut(s)	132
SmlI	CTYRAG	2 cut(s)	72, 643
SmoI	CTYRAG	2 cut(s)	72, 643
SpeI	ACTAGT	1 cut(s)	40
Sse9I	AATT	7 cut(s)	159, 226, 251, 560, 598, 661, 689
SseBI	AGGCCT	2 cut(s)	340, 480
SsiI	CCGC	1 cut(s)	276
SspMI	CTAG	1 cut(s)	41
StuI	AGGCCT	2 cut(s)	340, 480
StyI	CCWWGG	1 cut(s)	288
TaaI	ACNGT	4 cut(s)	85, 100, 188, 554
TasI	AATT	7 cut(s)	159, 226, 251, 560, 598, 661, 689
TatI	WGTACW	2 cut(s)	166, 375
TauI	GCSGC	1 cut(s)	279
TfiI	GAWTC	2 cut(s)	322, 400
Tru1I	TTAA	2 cut(s)	162, 296
Tru9I	TTAA	2 cut(s)	162, 296
TscAI	CASTG	3 cut(s)	97, 402, 535
TseFI	GTSAC	4 cut(s)	107, 182, 199, 679
TseI	GCWGC	5 cut(s)	29, 32, 56, 440, 589
Tsp45I	GTSAC	4 cut(s)	107, 182, 199, 679
TspDTI	ATGAA	4 cut(s)	10, 81, 611, 640
TspRI	CASTG	3 cut(s)	97, 402, 535
Tth111I	GACNNNGTC	1 cut(s)	205
Van91I	CCANNNNNTGG	1 cut(s)	155
VpaK11BI	GGWCC	1 cut(s)	132
XapI	RAATTY	2 cut(s)	598, 689
XceI	RCATGY	1 cut(s)	180
XcmI	CCANNNNNNNNNTGG	1 cut(s)	119
XspI	CTAG	1 cut(s)	41

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.