Rmu_sc0002119.1_g000026

Belongs to the helicase family. Dicer subfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002119.1
Physical Location & Seq
Forward (+)
130676 .. 139477
8802 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002119.1_g000026.1.cds

Sequence Viewer

Length: 5871 bp
atggatacagaggcggctagggttacaggggacagtggtggcaatgggggagaggttgttcgggcttcttactggctggatgcttgcgaggacattggggattttgtggacttttccgaaaattcgggtgctacggcagtggtggcgagtgggaatggctgcaatcaggaggaggtgggtgattttttcggcgggattgatcacattcttgacagtatcaaaagcggagctggattgccggatgggaagggggatggggtagtgggcggtggcaatgcggaggaggttggggcgactggcgtttccaatggactgagtggtgagaatggtcagagtgggggtcgaaattctgagggtgctaatggagatgggagagtggcggtggtggtggcttctgctgctaagcgtaatcacaatggtttgagcaagtatgagagtaatgggaggtggaatcggggtgtgagggaaagagatgtgagtggtgaagagcggtgccccaagagggttgcggtagataatggtaggaatgagaggtatagttcaggcagagtgcaatatcagctgagggagaggaattctggtcggaagaggcctcgtgatcctcgggatgacattgataggagggatagggatagggacagagatagggacagggatagagatcggactaggagaagagagagttatggtagtaataggagggatagtagagattgggaagcaaagggctattgggagagggataaattggggtcaaatgagcttgtttttagattaggagcttatgaacctcatcagaagaaagaggagaaagtcgctaatgacaaaatcaatgaaaaggatgtgaagaaatctgaagagctgaagaaagaaaagattcctgaggaacgagccagacagtatcaattggatgttcttgaacaggcaaagaagagcaatacgatagcttttcttgaaactggggctgggaagacactcattgccattctcctcatgcaaagtgtctgcaatgatttgcaaaagaagaataaaaagatgctttctgtgtttctagttcctaaagttccgcttgtttatcagcaagcagaagttattcgcgagcgaactggtttccaagtgggccattattgtggtgagatgggtcaagatttttgggatacacgaagatggcagcgtgagtttgatactaaacaggttctagtaatgacagctcaaattctattgaacattctaagacacagcattataaagatggaatcgattaatctattgattctggatgagtgccatcatgctgtgaagaaacatccatactctttagtgatgtccgagttctatcatacaaccccaaaagagaagagaccatctgtatttggaatgactgcttctcctgttaacttaaaaggtgtttccaatcaactagattgtgcaataaagattcgtaatcttgaaagtaaactggattccgttgtttgcaccataaaggaccggaaggacctggaaaagcatgttccaatgccctcagaaattgttgttgagtatgacaaagcagccagcttatggtcctttcacgaacagctaaaacaaatggaagtggaagttgaagaagctgcaaagtctagctctagaagaagtaaatggcagtttatgggagctagagatgctggggccaaggaagagctacgccaagtgtatggtgtttcagaaagaacagaaagtgatggggctgttaacctaattcagaagctgagggctatcaattatgcacttggtgaactgggtcagtggtgcgcctacaaggtggcacaatcattcttgacagctttacaaaatgatgaaagggcaaactaccagcttgatgtcaagtttcaagaaacttacctgatcagagttgtatctcttttacaatgtcatctgtcagagggcgctgcttctgacaaggaaacaaaactaccagattcagagagtgccgtttctcatgacgaaattgaggaaggagagctacctgatagtcatgttgtttctggtggggagcatgtagatgtgataatcggagctgctgtagctgatgggaaggtgacgccaaaagtgcagtcactaattaaagttcttctcaagtatcagcatacagaagatttccgtgcaatcatctttgtggagcgagttgtctccgctttagttcttcctaaggtctttgctgagcttccatctctaggttttatcgagtgtgcaagcttgattggccacaataatagtcaggaaatgcgaagtagccaaatgcaggacacaattgccaaattcaaggatggtcgtgtgacattgttagttgcaactagtgttgctgaggaaggacttgatattcgacagtgcaatgttgttattcgcttcgaccttgccaaaactgttttggcttatattcagtctaggggccgtgctagaaaacctgggtcagattatatcttgatggtggaaagggcaaatctgtcacatgaagcattcttacggaatgctagaaatagcgaggagactttacggaaagaagcaatagagaggactgacctgagtgatttgaaggatacttcaaggttaatttcagtggaaacagcaccaggtacagtgtatcaggtggaatcaactggtgctttggtgagcttaaattctgctgttggactaatccatttctactgctctcagcttccgagtgacaggtactcaatacttcatcctgaatttgttatggtgaggcatgagaagcaagaaggcccgactgaatattcatgcaagcttcaactcccttgtaatgcaccatttgagacacttgaaggccctgtgtgcagttcaatgcaccttgcgcaacaggctgtttgtttggctgcttgtaagaaactccatgagatgggagcatttaccgacatgctattgcccgacaggggagttggggaagaaaaagaaaaggttgacaagaatgacgaaggagatccacttcctggaactgctaggcacagagagttctatcccgaaggagtagctaatattctcctgggagaatggatcttagctggaagagatcttggcaatgaggccaaattgattcatgtttacatgtattctgtgaaatgtgtagacattggctcttcaaaagatcctttcttgactcaagtttcagattttgcaattctgttaggcaatgagctggatgcagaggtgttatcgatgtcgatggatctatttgttgctcggaccatgactataaaggcttcccttgtctttaggggttcaattcgtattactgaaagtcagttggcatcccttaaaagtttccatgtaagattgatgagtattgtactggatgtggatgttgaaccttccaccactccttgggatcctgcaaaggcttatttatttgtccccgtggttagcgataaatgtggagatcctatgaaagaaataaattggaatctggttgaaaatatacttggtgcagatgcgtggaacaatccccttcaaagagctaggcccgatgtttaccttggcacaaatgagcgaaccctaggaggtgacagaagggagtatggttttggtaaactgcgtcatggcatggcttttgggcaaaaatcccatccaacctatggtatcagaggagctgtggcacagtatgatgttgttaaagcttctggagtgatccctgatcggggtgcctttgaaatgcgaaaggatgtggatctgcagcaacgcaagttgatgatggcagatagttgtaccaatgttgaagatttggtagggaaaattgtgacagctgctcactcgggaaagagattttatgttgattcaatatgctacgatatgactgcagaaaactctttcccgaggaaagaaggttatcttggccctctggagtacagctcatatgctgattattacaagcaaaagtatggagttgagttgatgtataagaaacaacctctaataaaaggacgtggtgtctcatattgtaagaatctcctgtccccccggtttgaccacatggaagaacttgaaggtgaatcagaagagtctctggacaaaacatactacgtatttctccctcctgagctttgtttagtacacccactgtctggatcacttgtccgtggagcccaaagattaccctcaataatgagaagggtagaaagcatgctgctagcggttgaacttaaggagataataaattatcctgtccctgcttttaagattttggaagcattgactgctgcttcatgccaggagacattttgctatgaaagagctgagcttctgggtgatgcctacctcaaatgggttgttagtcgatatctctttcttaaataccctcagaaacacgaaggtcagcttactaggatgagacaacaaatggttagtaacatggttttgtatcattatgcattgaaaagaggacttcaatcatatatccaagcagatcgctttgctccgtctcgatgggcggctcctggggtgttgcctgtctttgatgagtatacaaaggatgaagaatcatctttgtttgaccaagaggatgtgactcgacggaaaacagatgacccggttgatgaatatgaggatgatgaattggaggatggcgagctggagagtgacttgagttcttatagggtcctgtcaagcaagacacttgcagatgttgttgaagcgcttattggggtttattatgtagaaggtgggaaaaatgctgctaaccatctcatgaaatgggtgggaattgatgtagagtttaatgctgatgagatagagagcacaacaaggccatctaatgttccagatagcattcttaggagcatcgactttgatgcgttagagggtgctttgaatattaaatttagagacaagggcctcttggtggaagccattagtcatgcttctcgaccatcttctggagtagcctgctatcagcggttggagtttgtgggtgatgctgtcttagatcatctcatcacaaagcacttgttcttcacatacacaaatctgcctccaggcaggttgaccgatcttagagctgctgctgttaacaatgaaaattttgcacgtgttgctgtaaaacataatctccatctacaccttcgacatggatccagtgctcttgaaagacagattcatgactttgtgaaggaagctgcaaatgaattaacaaagcctgggttcaactcatttggtttgggagattgtaaagctcccaaagttcttggtgacattattgaatctattgccggtgccatttttctcgatagtggacgtgatactgcagttgtttggaaggtgtttcaacctctgcttcaaccaatggtcaccccagagacactaccaatgcatccggtccgtgagctgcaagaaagatgccagcaacaggctgaaggcttggaatacaaagccagtcgaagtggcaatttggctactgttgaagtcttgatcgatggtgtcaaggtgggaattgctcagaatccacaaaagaagatggcacagaaactggctgccaggaatgctcttgctactttaaaagataaggacacagctgaagcaaaggagaggcaggaaagggaggaggaagataacgggaagaagaagaagaatggtagccaaacatttaccaggcaaaccttgaatgacatatgcttgcgtaaaaactggcctatgccattctacaggtgtgtcaatgagggtggccctgcacatgcaaagaagtttacgtttgctgtacgcgtgaataccactgacaggggatggatagatgaatgcgtaggagagcctatgccgagtgtcaagaaagccaaagactcggcagcagttcttctattggaattattgaataagttatacaagtga

Protein Analysis

1956

Amino Acids

219.2

Weight (kDa)

5.98

Isoelectric Point (pI)

41.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010310)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1247
Acc16I TGCGCA 1 cut(s) 2853
Acc36I ACCTGC 1 cut(s) 5019
AccB1I GGYRCC 3 cut(s) 492, 3695, 5261
AccB7I CCANNNNNTGG 7 cut(s) 1560, 2896, 2987, 3378, 3629, 4115, 4925
AccBSI CCGCTC 1 cut(s) 490
AccI GTMKAC 2 cut(s) 3123, 4514
AccII CGCG 2 cut(s) 1098, 5748
AcoI YGGCCR 1 cut(s) 2242
AcsI RAATTY 9 cut(s) 121, 346, 574, 1215, 2297, 2656, 2729, 4868, 5068
AcuI CTGAAG 4 cut(s) 876, 884, 5421, 5583
AcvI CACGTG 1 cut(s) 5078
AcyI GRCGYC 1 cut(s) 2081
AdeI CACNNNGTG 1 cut(s) 1772
AfaI GTAC 7 cut(s) 2614, 2711, 3345, 3760, 3899, 4104, 5745
AfeI AGCGCT 1 cut(s) 4686
AflII CTTAAG 1 cut(s) 4193
AflIII ACRYGT 3 cut(s) 3102, 5077, 5746
AhdI GACNNNNNGTC 1 cut(s) 3980
AhlI ACTAGT 1 cut(s) 2333
AjiI CACGTC 2 cut(s) 3977, 5285
AjuI GAANNNNNNNTTGG 6 cut(s) 3459, 3491, 3867, 3899, 4674, 4706
AloI GAACNNNNNNTCC 2 cut(s) 42, 74
Alw21I GWGCWC 2 cut(s) 4790, 5131
AlwNI CAGNNNCTG 2 cut(s) 1747, 5515
Ama87I CYCGRG 3 cut(s) 603, 3805, 3865
Aor51HI AGCGCT 1 cut(s) 4686
ApoI RAATTY 9 cut(s) 121, 346, 574, 1215, 2297, 2656, 2729, 4868, 5068
ArsI GACNNNNNNTTYG 4 cut(s) 2078, 2110, 2343, 2375
AseI ATTAAT 1 cut(s) 1263
Asp700I GAANNNNTTC 2 cut(s) 876, 1092
AspA2I CCTAGG 1 cut(s) 3550
AspLEI GCGC 4 cut(s) 1793, 1928, 2854, 4687
AsuC2I CCSGG 2 cut(s) 4012, 4580
AsuNHI GCTAGC 1 cut(s) 4180
AvaI CYCGRG 3 cut(s) 603, 3805, 3865
AvaII GGWCC 6 cut(s) 1486, 1495, 1563, 3240, 4648, 5365
AvrII CCTAGG 1 cut(s) 3550
AxyI CCTNAGG 2 cut(s) 882, 2187
BaeGI GKGCMC 1 cut(s) 497
BaeI ACNNNNGTAYC 2 cut(s) 5280, 5313
BalI TGGCCA 1 cut(s) 2244
BamHI GGATCC 2 cut(s) 3382, 5120
BanI GGYRCC 3 cut(s) 492, 3695, 5261
BanII GRGCYC 1 cut(s) 4138
BarI GAAGNNNNNNTAC 4 cut(s) 1986, 2018, 2484, 2516
BauI CACGAG 1 cut(s) 594
BbrPI CACGTG 1 cut(s) 5078
BbsI GAAGAC 1 cut(s) 977
Bbv12I GWGCWC 2 cut(s) 4790, 5131
BbvCI CCTCAGC 3 cut(s) 563, 1748, 2343
BceAI ACGGC 3 cut(s) 150, 1955, 2415
BcgI CGANNNNNNTGC 4 cut(s) 3830, 3864, 4823, 4857
BciVI GTATCC 2 cut(s) 1150, 2569
BclI TGATCA 2 cut(s) 199, 1884
BcnI CCSGG 2 cut(s) 4012, 4580
BcuI ACTAGT 1 cut(s) 2333
BfmI CTRYAG 5 cut(s) 2061, 3725, 3849, 5292, 5689
BfoI RGCGCY 2 cut(s) 1929, 4688
BfrI CTTAAG 1 cut(s) 4193
BfuAI ACCTGC 1 cut(s) 5019
BfuI GTATCC 2 cut(s) 1150, 2569
BglII AGATCT 1 cut(s) 3067
BlnI CCTAGG 1 cut(s) 3550
BlpI GCTNAGC 3 cut(s) 402, 2199, 4287
Bme18I GGWCC 6 cut(s) 1486, 1495, 1563, 3240, 4648, 5365
BmeRI GACNNNNNGTC 1 cut(s) 3980
BmeT110I CYCGRG 3 cut(s) 603, 3805, 3865
BmgBI CACGTC 2 cut(s) 3977, 5285
BmrI ACTGGG 2 cut(s) 969, 1787
BmtI GCTAGC 1 cut(s) 4184
BmuI ACTGGG 2 cut(s) 969, 1787
BpiI GAAGAC 1 cut(s) 977
BplI GAGNNNNNCTC 2 cut(s) 3887, 3919
BpmI CTGGAG 5 cut(s) 3696, 3914, 4643, 4947, 5007
Bpu10I CCTNAGC 4 cut(s) 563, 1748, 2343, 4089
Bpu1102I GCTNAGC 3 cut(s) 402, 2199, 4287
BpuEI CTTGAG 3 cut(s) 2099, 3141, 4654
BpuMI CCSGG 2 cut(s) 4012, 4580
Bsa29I ATCGAT 3 cut(s) 1259, 3212, 5460
BsaAI YACGTR 2 cut(s) 4075, 5078
BsaBI GATNNNNATC 2 cut(s) 660, 3720
BsaHI GRCGYC 1 cut(s) 2081
BsaI GGTCTC 1 cut(s) 1354
BsaWI WCCGGW 2 cut(s) 1488, 5362
Bse118I RCCGGY 1 cut(s) 5258
Bse21I CCTNAGG 2 cut(s) 882, 2187
Bse3DI GCAATG 7 cut(s) 49, 280, 978, 1015, 2377, 3082, 3193
Bse8I GATNNNNATC 2 cut(s) 660, 3720
BseCI ATCGAT 3 cut(s) 1259, 3212, 5460
BseJI GATNNNNATC 2 cut(s) 660, 3720
BseMI GCAATG 7 cut(s) 49, 280, 978, 1015, 2377, 3082, 3193
BseRI GAGGAG 7 cut(s) 185, 296, 821, 980, 2537, 3654, 5603
BseSI GKGCMC 1 cut(s) 497
BseYI CCCAGC 2 cut(s) 965, 1664
BsgI GTGCAG 4 cut(s) 2111, 2854, 3501, 5700
Bsh1236I CGCG 2 cut(s) 1098, 5748
BshNI GGYRCC 3 cut(s) 492, 3695, 5261
BshVI ATCGAT 3 cut(s) 1259, 3212, 5460
BsiHKAI GWGCWC 2 cut(s) 4790, 5131
BsiHKCI CYCGRG 3 cut(s) 603, 3805, 3865
BsiSI CCGG 6 cut(s) 239, 1489, 4012, 4580, 5259, 5363
BslFI GGGAC 6 cut(s) 44, 650, 662, 3392, 3991, 4202
BsmBI CGTCTC 1 cut(s) 4476
BsmFI GGGAC 6 cut(s) 44, 650, 662, 3392, 3991, 4202
BsmI GAATGC 5 cut(s) 2495, 2512, 4818, 5533, 5786
Bso31I GGTCTC 1 cut(s) 1354
BsoBI CYCGRG 3 cut(s) 603, 3805, 3865
Bsp1286I GDGCHC 4 cut(s) 497, 4138, 4790, 5131
Bsp1720I GCTNAGC 3 cut(s) 402, 2199, 4287
Bsp68I TCGCGA 1 cut(s) 1098
BspDI ATCGAT 3 cut(s) 1259, 3212, 5460
BspFNI CGCG 2 cut(s) 1098, 5748
BspHI TCATGA 3 cut(s) 1978, 4737, 5146
BspMAI CTGCAG 3 cut(s) 3729, 3853, 5296
BspMI ACCTGC 1 cut(s) 5019
BspOI GCTAGC 1 cut(s) 4184
BspQI GCTCTTC 5 cut(s) 480, 852, 926, 1671, 3139
BspT107I GGYRCC 3 cut(s) 492, 3695, 5261
BspTI CTTAAG 1 cut(s) 4193
BspTNI GGTCTC 1 cut(s) 1354
BsrBI CCGCTC 1 cut(s) 490
BsrDI GCAATG 7 cut(s) 49, 280, 978, 1015, 2377, 3082, 3193
BsrFI RCCGGY 1 cut(s) 5258
BssAI RCCGGY 1 cut(s) 5258
BssNAI GTATAC 1 cut(s) 4515
BssNI GRCGYC 1 cut(s) 2081
BssSI CACGAG 1 cut(s) 594
BssT1I CCWWGG 4 cut(s) 1671, 3377, 3529, 3550
Bst1107I GTATAC 1 cut(s) 4515
Bst2BI CACGAG 1 cut(s) 594
Bst4CI ACNGT 9 cut(s) 35, 215, 900, 2367, 2404, 2617, 3654, 4113, 5446
BstACI GRCGYC 1 cut(s) 2081
BstAFI CTTAAG 1 cut(s) 4193
BstAPI GCANNNNNTGC 2 cut(s) 4247, 5081
BstBAI YACGTR 2 cut(s) 4075, 5078
BstDSI CCRYGG 2 cut(s) 3411, 4129
BstEII GGTNACC 1 cut(s) 5335
BstFNI CGCG 2 cut(s) 1098, 5748
BstH2I RGCGCY 2 cut(s) 1929, 4688
BstHHI GCGC 4 cut(s) 1793, 1928, 2854, 4687
BstNSI RCATGY 6 cut(s) 1511, 2039, 2917, 3106, 4177, 5723
BstPI GGTNACC 1 cut(s) 5335
BstSFI CTRYAG 5 cut(s) 2061, 3725, 3849, 5292, 5689
BstSLI GKGCMC 1 cut(s) 497
BstSNI TACGTA 1 cut(s) 4075
BstUI CGCG 2 cut(s) 1098, 5748
BstV2I GAAGAC 1 cut(s) 977
BstX2I RGATCY 9 cut(s) 2977, 3051, 3067, 3142, 3223, 3382, 3433, 3721, 5120
BstXI CCANNNNNNTGG 2 cut(s) 1130, 1694
BstYI RGATCY 9 cut(s) 2977, 3051, 3067, 3142, 3223, 3382, 3433, 3721, 5120
BstZ17I GTATAC 1 cut(s) 4515
Bsu15I ATCGAT 3 cut(s) 1259, 3212, 5460
Bsu36I CCTNAGG 2 cut(s) 882, 2187
BsuI GTATCC 2 cut(s) 1150, 2569
BsuTUI ATCGAT 3 cut(s) 1259, 3212, 5460
BtgI CCRYGG 2 cut(s) 3411, 4129
BtrI CACGTC 2 cut(s) 3977, 5285
BtsI GCAGTG 1 cut(s) 144
BtsIMutI CAGTG 9 cut(s) 40, 144, 1790, 2372, 2601, 2622, 4109, 5131, 5757
BtuMI TCGCGA 1 cut(s) 1098
BveI ACCTGC 1 cut(s) 5019
CaiI CAGNNNCTG 2 cut(s) 1747, 5515
CciI TCATGA 3 cut(s) 1978, 4737, 5146
CfoI GCGC 4 cut(s) 1793, 1928, 2854, 4687
Cfr10I RCCGGY 1 cut(s) 5258
ClaI ATCGAT 3 cut(s) 1259, 3212, 5460
CpoI CGGWCCG 1 cut(s) 5365
CseI GACGC 2 cut(s) 2089, 3578
CsiI ACCWGGT 1 cut(s) 2608
Csp6I GTAC 7 cut(s) 2613, 2710, 3344, 3759, 3898, 4103, 5744
CspCI CAANNNNNGTGG 2 cut(s) 5689, 5724
CspI CGGWCCG 1 cut(s) 5365
CviQI GTAC 7 cut(s) 2613, 2710, 3344, 3759, 3898, 4103, 5744
DraI TTTAAA 1 cut(s) 5544
DraIII CACNNNGTG 1 cut(s) 1772
DriI GACNNNNNGTC 1 cut(s) 3980
EaeI YGGCCR 1 cut(s) 2242
Eam1105I GACNNNNNGTC 1 cut(s) 3980
Eco105I TACGTA 1 cut(s) 4075
Eco130I CCWWGG 4 cut(s) 1671, 3377, 3529, 3550
Eco147I AGGCCT 1 cut(s) 592
Eco24I GRGCYC 1 cut(s) 4138
Eco31I GGTCTC 1 cut(s) 1354
Eco32I GATATC 1 cut(s) 4331
Eco47I GGWCC 6 cut(s) 1486, 1495, 1563, 3240, 4648, 5365
Eco47III AGCGCT 1 cut(s) 4686
Eco57I CTGAAG 4 cut(s) 876, 884, 5421, 5583
Eco72I CACGTG 1 cut(s) 5078
Eco81I CCTNAGG 2 cut(s) 882, 2187
Eco88I CYCGRG 3 cut(s) 603, 3805, 3865
Eco91I GGTNACC 1 cut(s) 5335
EcoO109I RGGNCCY 4 cut(s) 1495, 2825, 4648, 4882
EcoO65I GGTNACC 1 cut(s) 5335
EcoRI GAATTC 1 cut(s) 574
EcoRV GATATC 1 cut(s) 4331
EcoT14I CCWWGG 4 cut(s) 1671, 3377, 3529, 3550
EcoT22I ATGCAT 2 cut(s) 4423, 5361
EcoT38I GRGCYC 1 cut(s) 4138
ErhI CCWWGG 4 cut(s) 1671, 3377, 3529, 3550
Esp3I CGTCTC 1 cut(s) 4476
FalI AAGNNNNNCTT 8 cut(s) 1053, 1085, 3867, 3899, 4353, 4385, 4871, 4903
FaqI GGGAC 6 cut(s) 44, 650, 662, 3392, 3991, 4202
FauI CCCGC 1 cut(s) 185
FauNDI CATATG 2 cut(s) 3907, 5657
FbaI TGATCA 2 cut(s) 199, 1884
FblI GTMKAC 2 cut(s) 3123, 4514
FriOI GRGCYC 1 cut(s) 4138
FspI TGCGCA 1 cut(s) 2853
GlaI GCGC 4 cut(s) 1792, 1927, 2853, 4686
GsaI CCCAGC 2 cut(s) 969, 1668
GsuI CTGGAG 5 cut(s) 3696, 3914, 4643, 4947, 5007
HaeII RGCGCY 2 cut(s) 1929, 4688
HapII CCGG 6 cut(s) 239, 1489, 4012, 4580, 5259, 5363
HgaI GACGC 2 cut(s) 2089, 3578
HhaI GCGC 4 cut(s) 1793, 1928, 2854, 4687
Hin1I GRCGYC 1 cut(s) 2081
Hin6I GCGC 4 cut(s) 1791, 1926, 2852, 4685
HinP1I GCGC 4 cut(s) 1791, 1926, 2852, 4685
HincII GTYRAC 5 cut(s) 1396, 1732, 2959, 5034, 5059
HindII GTYRAC 5 cut(s) 1396, 1732, 2959, 5034, 5059
HindIII AAGCTT 3 cut(s) 2233, 2783, 3669
HpaI GTTAAC 3 cut(s) 1396, 1732, 5059
HpaII CCGG 6 cut(s) 239, 1489, 4012, 4580, 5259, 5363
Hpy99I CGWCG 1 cut(s) 4566
HpyCH4III ACNGT 9 cut(s) 35, 215, 900, 2367, 2404, 2617, 3654, 4113, 5446
HpyCH4IV ACGT 5 cut(s) 3976, 4074, 5077, 5284, 5735
HpySE526I ACGT 5 cut(s) 3976, 4074, 5077, 5284, 5735
Hsp92I GRCGYC 1 cut(s) 2081
HspAI GCGC 4 cut(s) 1791, 1926, 2852, 4685
Ksp22I TGATCA 2 cut(s) 199, 1884
KspAI GTTAAC 3 cut(s) 1396, 1732, 5059
LguI GCTCTTC 5 cut(s) 480, 852, 926, 1671, 3139
MabI ACCWGGT 1 cut(s) 2608
MaeII ACGT 5 cut(s) 3976, 4074, 5077, 5284, 5735
MbiI CCGCTC 1 cut(s) 490
MfeI CAATTG 2 cut(s) 905, 2289
MflI RGATCY 9 cut(s) 2977, 3051, 3067, 3142, 3223, 3382, 3433, 3721, 5120
MhlI GDGCHC 4 cut(s) 497, 4138, 4790, 5131
MlsI TGGCCA 1 cut(s) 2244
MluI ACGCGT 1 cut(s) 5746
MluNI TGGCCA 1 cut(s) 2244
MlyI GAGTC 4 cut(s) 3148, 4061, 4552, 5816
MmeI TCCRAC 4 cut(s) 563, 2647, 3647, 4929
Mox20I TGGCCA 1 cut(s) 2244
Mph1103I ATGCAT 2 cut(s) 4423, 5361
MroXI GAANNNNTTC 2 cut(s) 876, 1092
MscI TGGCCA 1 cut(s) 2244
MslI CAYNNNNRTG 4 cut(s) 1128, 1165, 2040, 2153
Msp20I TGGCCA 1 cut(s) 2244
MspA1I CMGCKG 4 cut(s) 562, 3797, 4945, 5561
MspCI CTTAAG 1 cut(s) 4193
MspI CCGG 6 cut(s) 239, 1489, 4012, 4580, 5259, 5363
MunI CAATTG 2 cut(s) 905, 2289
Mva1269I GAATGC 5 cut(s) 2495, 2512, 4818, 5533, 5786
MvnI CGCG 2 cut(s) 1098, 5748
NciI CCSGG 2 cut(s) 4012, 4580
NdeI CATATG 2 cut(s) 3907, 5657
NheI GCTAGC 1 cut(s) 4180
NmeAIII GCCGAG 2 cut(s) 5804, 5826
NruI TCGCGA 1 cut(s) 1098
NsbI TGCGCA 1 cut(s) 2853
NsiI ATGCAT 2 cut(s) 4423, 5361
NspI RCATGY 6 cut(s) 1511, 2039, 2917, 3106, 4177, 5723
PaeI GCATGC 1 cut(s) 4177
PagI TCATGA 3 cut(s) 1978, 4737, 5146
PceI AGGCCT 1 cut(s) 592
PciI ACATGT 1 cut(s) 3102
PciSI GCTCTTC 5 cut(s) 480, 852, 926, 1671, 3139
PctI GAATGC 5 cut(s) 2495, 2512, 4818, 5533, 5786
PdmI GAANNNNTTC 2 cut(s) 876, 1092
PflMI CCANNNNNTGG 7 cut(s) 1560, 2896, 2987, 3378, 3629, 4115, 4925
PfoI TCCNGGA 1 cut(s) 2986
PleI GAGTC 4 cut(s) 3148, 4060, 4552, 5816
PmaCI CACGTG 1 cut(s) 5078
PmlI CACGTG 1 cut(s) 5078
PpsI GAGTC 4 cut(s) 3148, 4060, 4552, 5816
Ppu21I YACGTR 2 cut(s) 4075, 5078
PpuMI RGGWCCY 2 cut(s) 1495, 4648
PscI ACATGT 1 cut(s) 3102
PshBI ATTAAT 1 cut(s) 1263
PsiI TTATAA 1 cut(s) 1247
Psp5II RGGWCCY 2 cut(s) 1495, 4648
PspCI CACGTG 1 cut(s) 5078
PspEI GGTNACC 1 cut(s) 5335
PspFI CCCAGC 2 cut(s) 965, 1664
PspPPI RGGWCCY 2 cut(s) 1495, 4648
PstI CTGCAG 3 cut(s) 3729, 3853, 5296
PstNI CAGNNNCTG 2 cut(s) 1747, 5515
PsuI RGATCY 9 cut(s) 2977, 3051, 3067, 3142, 3223, 3382, 3433, 3721, 5120
PvuII CAGCTG 3 cut(s) 562, 3797, 5561
RruI TCGCGA 1 cut(s) 1098
RsaI GTAC 7 cut(s) 2614, 2711, 3345, 3760, 3899, 4104, 5745
RsaNI GTAC 7 cut(s) 2613, 2710, 3344, 3759, 3898, 4103, 5744
RseI CAYNNNNRTG 4 cut(s) 1128, 1165, 2040, 2153
Rsr2I CGGWCCG 1 cut(s) 5365
RsrII CGGWCCG 1 cut(s) 5365
SapI GCTCTTC 5 cut(s) 480, 852, 926, 1671, 3139
SchI GAGTC 4 cut(s) 3148, 4061, 4552, 5816
SduI GDGCHC 4 cut(s) 497, 4138, 4790, 5131
SexAI ACCWGGT 1 cut(s) 2608
SfcI CTRYAG 5 cut(s) 2061, 3725, 3849, 5292, 5689
SinI GGWCC 6 cut(s) 1486, 1495, 1563, 3240, 4648, 5365
SmiMI CAYNNNNRTG 4 cut(s) 1128, 1165, 2040, 2153
SmlI CTYRAG 4 cut(s) 2114, 3156, 4193, 4633
SmoI CTYRAG 4 cut(s) 2114, 3156, 4193, 4633
SnaBI TACGTA 1 cut(s) 4075
SpeI ACTAGT 1 cut(s) 2333
SphI GCATGC 1 cut(s) 4177
SseBI AGGCCT 1 cut(s) 592
SspI AATATT 3 cut(s) 2774, 3034, 4864
StuI AGGCCT 1 cut(s) 592
StyI CCWWGG 4 cut(s) 1671, 3377, 3529, 3550
TaaI ACNGT 9 cut(s) 35, 215, 900, 2367, 2404, 2617, 3654, 4113, 5446
TaiI ACGT 5 cut(s) 3979, 4077, 5080, 5287, 5738
TaqII GACCGA 1 cut(s) 5051
TatI WGTACW 3 cut(s) 3343, 3897, 4102
TauI GCSGC 2 cut(s) 17, 4484
TscAI CASTG 9 cut(s) 40, 144, 1790, 2372, 2601, 2622, 4116, 5131, 5764
TspGWI ACGGA 8 cut(s) 1456, 2129, 2518, 2548, 4118, 4458, 4579, 5357
TspRI CASTG 9 cut(s) 40, 144, 1790, 2372, 2601, 2622, 4116, 5131, 5764
Van91I CCANNNNNTGG 7 cut(s) 1560, 2896, 2987, 3378, 3629, 4115, 4925
Vha464I CTTAAG 1 cut(s) 4193
VpaK11BI GGWCC 6 cut(s) 1486, 1495, 1563, 3240, 4648, 5365
VspI ATTAAT 1 cut(s) 1263
XapI RAATTY 9 cut(s) 121, 346, 574, 1215, 2297, 2656, 2729, 4868, 5068
XbaI TCTAGA 1 cut(s) 1625
XceI RCATGY 6 cut(s) 1511, 2039, 2917, 3106, 4177, 5723
XcmI CCANNNNNNNNNTGG 2 cut(s) 2404, 3626
XmaJI CCTAGG 1 cut(s) 3550
XmiI GTMKAC 2 cut(s) 3123, 4514
XmnI GAANNNNTTC 2 cut(s) 876, 1092
Zsp2I ATGCAT 2 cut(s) 4423, 5361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.