Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002288.1

Orthogroup ID

OG0006879

Physical Location & Seq

Genomic Coordinates Reverse (-)

90859 .. 95720

Gene Structure 4862 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002288.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1290 bp

atgtcacaacaacaggcgaagtctcgtggttgggctgcctttgacctcaagcagcgtcagaaaaaaggccttgagcctcaaattgagaaggaccctttccctcctatagcgcccactatcacgtctctgcacccttgtgaaaatgcactgaggaataatgaggttccgagcaaacctttctcatctgtattcctctcttctgcacatgttgtatctatggcagagaatagggatggtaaaagatccttattagatggaaattctagtaggaagcatacttccatggaagatcagagatcttccataaagaagatcaaggatctttactcttgggctgatgatagtttggtggaggatattatggctgcagtggataatgatattactaaggcctcaaatttattaaaaacaatggtctccccgagaagatctgaagagaataaggaaaccaacatttcaaaaatagattccagttcagatgcttccttgagcgataaaacaagggataaaagttttccttcagaatctgcagctgatattgctggactcagctctactattgagaaatgtctcaaagagaataacatagaatggttaaatgacaatgatttatatggaccaaagctttctaatggtgctggaaatgtgaaactgactactgggagtctggagtctgtacccattgaacctgagtgggaagaggatgatgtttacttgaggatacgaaaggatgcattaaggatgatgaggtcagcgtctcagcattcgaaagctgccactaatgcctttgtaagaggtgaccattattctgctcaacagtactcgatcaaggctagagaggaatggttagctgccgaacgccttaataacaaggctgctaaggaaattttaagtatcaggaatagcaaaaatgatgtttggaaattagatttacatggtcttcatgcatcagaagcaattcatgcattgcaagaacacctggagaaaattgaacggaaaatactttctaatgatttagtgtcgccaaacagagttaatatggaaagcaacattaaacgttcatcagttgagtcttttagttgcatggacacagaaaagttggatcaactacaggcatcatcaagacaaagaccaacatccttacaagtcataacaggtataggcaatcatagccgaggacatgctgcacttccaacagctgtgagaagtttccttagtgagaatggatatcgctttgaagagttgaggccaggtgtgatcactgttcggcctaagttccgtcataggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1771 Smr

Protein Analysis

429

Amino Acids

48.16

Weight (kDa)

8.53

Isoelectric Point (pI)

57.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006879)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G23520 AT5G23520
fragaria_vesca	FvH4_1g22090 FvH4_1g22090 FvH4_1g22090 FvH4_1g22090 FvH4_1g22090 FvH4_1g22090
malus_domestica	MD15G1334300.v1.1
prunus_persica	Prupe.6G175200_v2.0.a1 Prupe.6G175200_v2.0.a1 Prupe.6G175200_v2.0.a1
pyrus_communis	pycom15g29120
rosa_chinensis	RchiOBHm_Chr2g0116171
rosa_laevigata	RLG00000018245
rosa_multiflora	Rmu_sc0000863.1_g000045 Rmu_sc0002288.1_g000020 Rmu_sc0004693.1_g000001 Rmu_sc0006942.1_g000002
rosa_roxburghii	Rroxscaffold_2G00127440
rosa_rugosa	Rorug02G0204300 Rorug02G0204400 Rorug02G0204500 Rorug02G0204600
rosa_wichuraiana	Rw1G013010 Rw2G020400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	1057
AclWI	GGATC	3 cut(s)	237, 327, 1110
AcsI	RAATTY	3 cut(s)	259, 397, 885
AcuI	CTGAAG	2 cut(s)	453, 504
AfaI	GTAC	2 cut(s)	678, 821
AflIII	ACRYGT	1 cut(s)	205
AgsI	TTSAA	4 cut(s)	459, 686, 992, 1238
AjiI	CACGTC	1 cut(s)	123
AjnI	CCWGG	2 cut(s)	978, 1249
AleI	CACNNNNGTG	1 cut(s)	135
AluBI	AGCT	6 cut(s)	533, 552, 625, 773, 851, 1199
AluI	AGCT	6 cut(s)	533, 552, 625, 773, 851, 1199
Alw26I	GTCTC	5 cut(s)	27, 129, 421, 575, 762
AlwI	GGATC	3 cut(s)	237, 327, 1110
AlwNI	CAGNNNCTG	1 cut(s)	527
Ama87I	CYCGRG	1 cut(s)	421
AoxI	GGCC	4 cut(s)	67, 390, 1247, 1268
ApeKI	GCWGC	8 cut(s)	35, 52, 365, 530, 773, 851, 875, 1184
ApoI	RAATTY	3 cut(s)	259, 397, 885
Asp700I	GAANNNNTTC	1 cut(s)	957
AspLEI	GCGC	1 cut(s)	112
AspS9I	GGNCC	2 cut(s)	91, 617
AsuHPI	GGTGA	1 cut(s)	809
AsuII	TTCGAA	1 cut(s)	767
AvaI	CYCGRG	1 cut(s)	421
AvaII	GGWCC	2 cut(s)	91, 617
BauI	CACGAG	1 cut(s)	24
BbsI	GAAGAC	1 cut(s)	932
BbvI	GCAGC	8 cut(s)	22, 64, 352, 542, 760, 838, 862, 1171
BccI	CCATC	2 cut(s)	227, 248
BciT130I	CCWGG	2 cut(s)	980, 1251
BciVI	GTATCC	1 cut(s)	714
BclI	TGATCA	1 cut(s)	1257
BcoDI	GTCTC	5 cut(s)	27, 129, 421, 575, 762
BfaI	CTAG	2 cut(s)	264, 834
BfmI	CTRYAG	4 cut(s)	105, 366, 528, 1109
BfoI	RGCGCY	1 cut(s)	113
BfuI	GTATCC	1 cut(s)	714
BglII	AGATCT	2 cut(s)	296, 428
BisI	GCNGC	8 cut(s)	36, 53, 366, 531, 774, 852, 876, 1185
BlsI	GCNGC	8 cut(s)	37, 54, 367, 532, 775, 853, 877, 1186
BmcAI	AGTACT	1 cut(s)	821
Bme1390I	CCNGG	2 cut(s)	980, 1251
Bme18I	GGWCC	2 cut(s)	91, 617
BmeT110I	CYCGRG	1 cut(s)	421
BmgBI	CACGTC	1 cut(s)	123
BmgT120I	GGNCC	2 cut(s)	91, 617
BmiI	GGNNCC	2 cut(s)	93, 165
BmrFI	CCNGG	2 cut(s)	980, 1251
BmrI	ACTGGG	1 cut(s)	669
BmsI	GCATC	4 cut(s)	469, 721, 956, 1124
BmuI	ACTGGG	1 cut(s)	669
BpiI	GAAGAC	1 cut(s)	932
BpmI	CTGGAG	2 cut(s)	689, 1001
Bpu10I	CCTNAGC	1 cut(s)	879
Bpu14I	TTCGAA	1 cut(s)	767
BpuEI	CTTGAG	4 cut(s)	32, 92, 508, 736
BsaI	GGTCTC	1 cut(s)	421
BsaJI	CCNNGG	2 cut(s)	282, 1174
Bse1I	ACTGG	2 cut(s)	471, 664
Bse3DI	GCAATG	1 cut(s)	965
BseBI	CCWGG	2 cut(s)	980, 1251
BseDI	CCNNGG	2 cut(s)	282, 1174
BseGI	GGATG	5 cut(s)	238, 709, 736, 747, 1136
BseMI	GCAATG	1 cut(s)	965
BseMII	CTCAG	4 cut(s)	140, 562, 681, 773
BseNI	ACTGG	2 cut(s)	471, 664
BseXI	GCAGC	8 cut(s)	22, 64, 352, 542, 760, 838, 862, 1171
BsgI	GTGCAG	3 cut(s)	113, 186, 1170
BshFI	GGCC	4 cut(s)	69, 392, 1249, 1270
BsiHKCI	CYCGRG	1 cut(s)	421
BsmAI	GTCTC	5 cut(s)	27, 129, 421, 575, 762
BsmBI	CGTCTC	2 cut(s)	129, 762
BsmI	GAATGC	1 cut(s)	763
BsnI	GGCC	4 cut(s)	69, 392, 1249, 1270
Bso31I	GGTCTC	1 cut(s)	421
BsoBI	CYCGRG	1 cut(s)	421
Bsp119I	TTCGAA	1 cut(s)	767
Bsp143I	GATC	9 cut(s)	242, 289, 296, 312, 319, 428, 825, 1102, 1257
Bsp19I	CCATGG	1 cut(s)	282
BspANI	GGCC	4 cut(s)	69, 392, 1249, 1270
BspCNI	CTCAG	4 cut(s)	141, 561, 682, 772
BspLI	GGNNCC	2 cut(s)	93, 165
BspMAI	CTGCAG	2 cut(s)	370, 532
BspPI	GGATC	3 cut(s)	237, 327, 1110
BspT104I	TTCGAA	1 cut(s)	767
BspTNI	GGTCTC	1 cut(s)	421
BsrDI	GCAATG	1 cut(s)	965
BsrI	ACTGG	2 cut(s)	471, 664
BssECI	CCNNGG	2 cut(s)	282, 1174
BssMI	GATC	9 cut(s)	242, 289, 296, 312, 319, 428, 825, 1102, 1257
BssSI	CACGAG	1 cut(s)	24
BssT1I	CCWWGG	1 cut(s)	282
Bst2BI	CACGAG	1 cut(s)	24
Bst2UI	CCWGG	2 cut(s)	980, 1251
Bst4CI	ACNGT	2 cut(s)	819, 1264
Bst6I	CTCTTC	4 cut(s)	202, 429, 693, 1233
BstAPI	GCANNNNNTGC	1 cut(s)	962
BstBI	TTCGAA	1 cut(s)	767
BstDEI	CTNAG	8 cut(s)	149, 387, 548, 690, 759, 879, 1214, 1272
BstDSI	CCRYGG	1 cut(s)	282
BstEII	GGTNACC	1 cut(s)	797
BstF5I	GGATG	5 cut(s)	238, 709, 736, 747, 1136
BstH2I	RGCGCY	1 cut(s)	113
BstHHI	GCGC	1 cut(s)	112
BstKTI	GATC	9 cut(s)	245, 292, 299, 315, 322, 431, 828, 1105, 1260
BstMAI	GTCTC	5 cut(s)	27, 129, 421, 575, 762
BstMBI	GATC	9 cut(s)	242, 289, 296, 312, 319, 428, 825, 1102, 1257
BstMWI	GCNNNNNNNGC	5 cut(s)	539, 782, 953, 962, 1170
BstNI	CCWGG	2 cut(s)	980, 1251
BstNSI	RCATGY	2 cut(s)	209, 1184
BstPI	GGTNACC	1 cut(s)	797
BstSCI	CCNGG	2 cut(s)	978, 1249
BstSFI	CTRYAG	4 cut(s)	105, 366, 528, 1109
BstV1I	GCAGC	8 cut(s)	22, 64, 352, 542, 760, 838, 862, 1171
BstV2I	GAAGAC	1 cut(s)	932
BstX2I	RGATCY	4 cut(s)	242, 296, 319, 428
BstYI	RGATCY	4 cut(s)	242, 296, 319, 428
BsuI	GTATCC	1 cut(s)	714
BsuRI	GGCC	4 cut(s)	69, 392, 1249, 1270
BtgI	CCRYGG	1 cut(s)	282
BtrI	CACGTC	1 cut(s)	123
BtsCI	GGATG	5 cut(s)	238, 709, 736, 747, 1136
BtsI	GCAGTG	1 cut(s)	375
BtsIMutI	CAGTG	3 cut(s)	146, 375, 1260
CaiI	CAGNNNCTG	1 cut(s)	527
CfoI	GCGC	1 cut(s)	112
Cfr13I	GGNCC	2 cut(s)	91, 617
CseI	GACGC	2 cut(s)	44, 744
Csp6I	GTAC	2 cut(s)	677, 820
CviAII	CATG	7 cut(s)	206, 283, 935, 944, 962, 1084, 1181
CviQI	GTAC	2 cut(s)	677, 820
DdeI	CTNAG	8 cut(s)	149, 387, 548, 690, 759, 879, 1214, 1272
DpnI	GATC	9 cut(s)	244, 291, 298, 314, 321, 430, 827, 1104, 1259
DpnII	GATC	9 cut(s)	242, 289, 296, 312, 319, 428, 825, 1102, 1257
Eam1104I	CTCTTC	4 cut(s)	202, 429, 693, 1233
EarI	CTCTTC	4 cut(s)	202, 429, 693, 1233
Eco130I	CCWWGG	1 cut(s)	282
Eco147I	AGGCCT	2 cut(s)	69, 392
Eco31I	GGTCTC	1 cut(s)	421
Eco32I	GATATC	1 cut(s)	1229
Eco47I	GGWCC	2 cut(s)	91, 617
Eco57I	CTGAAG	2 cut(s)	453, 504
Eco88I	CYCGRG	1 cut(s)	421
Eco91I	GGTNACC	1 cut(s)	797
EcoO109I	RGGNCCY	1 cut(s)	91
EcoO65I	GGTNACC	1 cut(s)	797
EcoRII	CCWGG	2 cut(s)	978, 1249
EcoRV	GATATC	1 cut(s)	1229
EcoT14I	CCWWGG	1 cut(s)	282
EcoT22I	ATGCAT	3 cut(s)	736, 949, 967
ErhI	CCWWGG	1 cut(s)	282
Esp3I	CGTCTC	2 cut(s)	129, 762
FaeI	CATG	7 cut(s)	209, 286, 938, 947, 965, 1087, 1184
FalI	AAGNNNNNCTT	2 cut(s)	502, 534
FatI	CATG	7 cut(s)	205, 282, 934, 943, 961, 1083, 1180
FbaI	TGATCA	1 cut(s)	1257
Fnu4HI	GCNGC	8 cut(s)	36, 53, 366, 531, 774, 852, 876, 1185
FokI	GGATG	5 cut(s)	245, 716, 743, 754, 1123
Fsp4HI	GCNGC	8 cut(s)	36, 53, 366, 531, 774, 852, 876, 1185
FspBI	CTAG	2 cut(s)	264, 834
GlaI	GCGC	1 cut(s)	111
GluI	GCNGC	8 cut(s)	36, 53, 366, 531, 774, 852, 876, 1185
GsuI	CTGGAG	2 cut(s)	689, 1001
HaeII	RGCGCY	1 cut(s)	113
HaeIII	GGCC	4 cut(s)	69, 392, 1249, 1270
HgaI	GACGC	2 cut(s)	44, 744
HhaI	GCGC	1 cut(s)	112
Hin1II	CATG	7 cut(s)	209, 286, 938, 947, 965, 1087, 1184
Hin6I	GCGC	1 cut(s)	110
HinP1I	GCGC	1 cut(s)	110
HindIII	AAGCTT	1 cut(s)	623
HinfI	GANTC	6 cut(s)	467, 524, 546, 664, 671, 1070
HphI	GGTGA	1 cut(s)	809
Hpy166II	GTNNAC	1 cut(s)	712
Hpy188I	TCNGA	7 cut(s)	60, 168, 294, 433, 478, 523, 952
Hpy188III	TCNNGA	3 cut(s)	668, 898, 1122
Hpy8I	GTNNAC	1 cut(s)	712
HpyAV	CCTTC	2 cut(s)	82, 528
HpyCH4III	ACNGT	2 cut(s)	819, 1264
HpyCH4IV	ACGT	2 cut(s)	122, 1057
HpyF10VI	GCNNNNNNNGC	5 cut(s)	539, 782, 953, 962, 1170
HpyF3I	CTNAG	8 cut(s)	149, 387, 548, 690, 759, 879, 1214, 1272
HpySE526I	ACGT	2 cut(s)	122, 1057
Hsp92II	CATG	7 cut(s)	209, 286, 938, 947, 965, 1087, 1184
HspAI	GCGC	1 cut(s)	110
Ksp22I	TGATCA	1 cut(s)	1257
Kzo9I	GATC	9 cut(s)	242, 289, 296, 312, 319, 428, 825, 1102, 1257
Lsp1109I	GCAGC	8 cut(s)	22, 64, 352, 542, 760, 838, 862, 1171
LweI	GCATC	4 cut(s)	469, 721, 956, 1124
MaeI	CTAG	2 cut(s)	264, 834
MaeII	ACGT	2 cut(s)	122, 1057
MaeIII	GTNAC	2 cut(s)	3, 797
MalI	GATC	9 cut(s)	244, 291, 298, 314, 321, 430, 827, 1104, 1259
MboI	GATC	9 cut(s)	242, 289, 296, 312, 319, 428, 825, 1102, 1257
MboII	GAAGA	9 cut(s)	189, 291, 299, 322, 438, 446, 710, 932, 1250
MflI	RGATCY	4 cut(s)	242, 296, 319, 428
MluCI	AATT	7 cut(s)	81, 259, 397, 885, 923, 957, 987
MlyI	GAGTC	4 cut(s)	540, 673, 680, 1079
MmeI	TCCRAC	2 cut(s)	1080, 1217
Mph1103I	ATGCAT	3 cut(s)	736, 949, 967
MroXI	GAANNNNTTC	1 cut(s)	957
MseI	TTAA	7 cut(s)	404, 596, 737, 864, 890, 1035, 1053
MslI	CAYNNNNRTG	1 cut(s)	135
MspA1I	CMGCKG	2 cut(s)	533, 1199
MspR9I	CCNGG	2 cut(s)	980, 1251
Mva1269I	GAATGC	1 cut(s)	763
MvaI	CCWGG	2 cut(s)	980, 1251
MwoI	GCNNNNNNNGC	5 cut(s)	539, 782, 953, 962, 1170
NcoI	CCATGG	1 cut(s)	282
NdeII	GATC	9 cut(s)	242, 289, 296, 312, 319, 428, 825, 1102, 1257
NlaIII	CATG	7 cut(s)	209, 286, 938, 947, 965, 1087, 1184
NlaIV	GGNNCC	2 cut(s)	93, 165
NmeAIII	GCCGAG	1 cut(s)	1199
NmuCI	GTSAC	2 cut(s)	3, 797
NsiI	ATGCAT	3 cut(s)	736, 949, 967
NspI	RCATGY	2 cut(s)	209, 1184
NspV	TTCGAA	1 cut(s)	767
OliI	CACNNNNGTG	1 cut(s)	135
PceI	AGGCCT	2 cut(s)	69, 392
PciI	ACATGT	1 cut(s)	205
PctI	GAATGC	1 cut(s)	763
PdmI	GAANNNNTTC	1 cut(s)	957
PfeI	GAWTC	2 cut(s)	467, 524
PkrI	GCNGC	8 cut(s)	37, 54, 367, 532, 775, 853, 877, 1186
PleI	GAGTC	4 cut(s)	540, 672, 679, 1078
PpsI	GAGTC	4 cut(s)	540, 672, 679, 1078
PpuMI	RGGWCCY	1 cut(s)	91
PscI	ACATGT	1 cut(s)	205
Psp1406I	AACGTT	1 cut(s)	1057
Psp5II	RGGWCCY	1 cut(s)	91
Psp6I	CCWGG	2 cut(s)	978, 1249
PspEI	GGTNACC	1 cut(s)	797
PspGI	CCWGG	2 cut(s)	978, 1249
PspN4I	GGNNCC	2 cut(s)	93, 165
PspPI	GGNCC	2 cut(s)	91, 617
PspPPI	RGGWCCY	1 cut(s)	91
PsrI	GAACNNNNNNTAC	2 cut(s)	984, 1016
PstI	CTGCAG	2 cut(s)	370, 532
PstNI	CAGNNNCTG	1 cut(s)	527
PsuI	RGATCY	4 cut(s)	242, 296, 319, 428
PvuII	CAGCTG	2 cut(s)	533, 1199
RsaI	GTAC	2 cut(s)	678, 821
RsaNI	GTAC	2 cut(s)	677, 820
RseI	CAYNNNNRTG	1 cut(s)	135
SaqAI	TTAA	7 cut(s)	404, 596, 737, 864, 890, 1035, 1053
SatI	GCNGC	8 cut(s)	36, 53, 366, 531, 774, 852, 876, 1185
Sau3AI	GATC	9 cut(s)	242, 289, 296, 312, 319, 428, 825, 1102, 1257
Sau96I	GGNCC	2 cut(s)	91, 617
ScaI	AGTACT	1 cut(s)	821
SchI	GAGTC	4 cut(s)	540, 673, 680, 1079
ScrFI	CCNGG	2 cut(s)	980, 1251
SfaNI	GCATC	4 cut(s)	469, 721, 956, 1124
SfcI	CTRYAG	4 cut(s)	105, 366, 528, 1109
SfuI	TTCGAA	1 cut(s)	767
SinI	GGWCC	2 cut(s)	91, 617
SmiMI	CAYNNNNRTG	1 cut(s)	135
SmlI	CTYRAG	4 cut(s)	47, 71, 487, 715
SmoI	CTYRAG	4 cut(s)	47, 71, 487, 715
Sse9I	AATT	7 cut(s)	81, 259, 397, 885, 923, 957, 987
SseBI	AGGCCT	2 cut(s)	69, 392
SspMI	CTAG	2 cut(s)	264, 834
StuI	AGGCCT	2 cut(s)	69, 392
StyD4I	CCNGG	2 cut(s)	978, 1249
StyI	CCWWGG	1 cut(s)	282
TaaI	ACNGT	2 cut(s)	819, 1264
TaiI	ACGT	2 cut(s)	125, 1060
TaqI	TCGA	2 cut(s)	767, 824
TasI	AATT	7 cut(s)	81, 259, 397, 885, 923, 957, 987
TatI	WGTACW	1 cut(s)	819
TfiI	GAWTC	2 cut(s)	467, 524
Tru1I	TTAA	7 cut(s)	404, 596, 737, 864, 890, 1035, 1053
Tru9I	TTAA	7 cut(s)	404, 596, 737, 864, 890, 1035, 1053
TscAI	CASTG	3 cut(s)	153, 375, 1267
TseFI	GTSAC	2 cut(s)	3, 797
TseI	GCWGC	8 cut(s)	35, 52, 365, 530, 773, 851, 875, 1184
Tsp45I	GTSAC	2 cut(s)	3, 797
TspDTI	ATGAA	3 cut(s)	932, 950, 1050
TspGWI	ACGGA	2 cut(s)	1009, 1268
TspRI	CASTG	3 cut(s)	153, 375, 1267
VpaK11BI	GGWCC	2 cut(s)	91, 617
XapI	RAATTY	3 cut(s)	259, 397, 885
XceI	RCATGY	2 cut(s)	209, 1184
XmnI	GAANNNNTTC	1 cut(s)	957
XspI	CTAG	2 cut(s)	264, 834
ZrmI	AGTACT	1 cut(s)	821
Zsp2I	ATGCAT	3 cut(s)	736, 949, 967

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.