Rmu_sc0002398.1_g000004

Cucumber peeling cupredoxin-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002398.1
Physical Location & Seq
Reverse (-)
23312 .. 24988
1677 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002398.1_g000004.1.cds

Sequence Viewer

Length: 447 bp
atggtcggacgggatttgggatcagggatttggtctggtgatcggagaatggggcggagttggtccaagcttgttggatctcagtttgtggcggtgactgcaaggggagggggtgtgtggcagcagggagtttccggctgtatggcgtcgttcaagcattcggatcttgcagcagggattaaggaggacgacggtgggtttggaatggacgacagtgggtgtccaatttctggcaatgtttgttcgacggcggctggggtccgagagcggcggcggagcgacgatctgggagataggaagattgtggcagcgcagacggcgcatgtggtgggagatagcataggctggaccataccacagaacggtgctcaagagtatttcacttgggcgtctggacagaagttcctagttggtgatatatgttctgagtatgattcccatctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

148

Amino Acids

15.68

Weight (kDa)

5.86

Isoelectric Point (pI)

33.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 230
AccBSI CCGCTC 1 cut(s) 268
AciI CCGC 6 cut(s) 55, 92, 251, 268, 271, 274
AclWI GGATC 3 cut(s) 28, 85, 171
AcyI GRCGYC 2 cut(s) 146, 389
AfiI CCNNNNNNNGG 2 cut(s) 230, 362
AgsI TTSAA 1 cut(s) 154
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
Alw21I GWGCWC 1 cut(s) 370
AlwI GGATC 3 cut(s) 28, 85, 171
ApeKI GCWGC 3 cut(s) 121, 170, 308
ArsI GACNNNNNNTTYG 2 cut(s) 182, 214
AspLEI GCGC 2 cut(s) 313, 322
AspS9I GGNCC 3 cut(s) 63, 259, 348
AsuHPI GGTGA 3 cut(s) 50, 106, 425
AvaII GGWCC 3 cut(s) 63, 259, 348
Bbv12I GWGCWC 1 cut(s) 370
BbvI GCAGC 3 cut(s) 133, 182, 320
BceAI ACGGC 2 cut(s) 264, 333
BfaI CTAG 2 cut(s) 407, 445
BisI GCNGC 6 cut(s) 122, 171, 252, 269, 272, 309
BlsI GCNGC 6 cut(s) 123, 172, 253, 270, 273, 310
Bme18I GGWCC 3 cut(s) 63, 259, 348
BmgT120I GGNCC 3 cut(s) 63, 259, 348
BmiI GGNNCC 1 cut(s) 260
BpuEI CTTGAG 1 cut(s) 354
BsaBI GATNNNNATC 1 cut(s) 438
BsaHI GRCGYC 2 cut(s) 146, 389
BsaXI ACNNNNNCTCC 2 cut(s) 99, 129
Bsc4I CCNNNNNNNGG 2 cut(s) 230, 362
Bse3DI GCAATG 1 cut(s) 241
Bse8I GATNNNNATC 1 cut(s) 438
BseJI GATNNNNATC 1 cut(s) 438
BseLI CCNNNNNNNGG 2 cut(s) 230, 362
BseMI GCAATG 1 cut(s) 241
BseMII CTCAG 2 cut(s) 95, 417
BseXI GCAGC 3 cut(s) 133, 182, 320
BseYI CCCAGC 1 cut(s) 254
BsiHKAI GWGCWC 1 cut(s) 370
BsiSI CCGG 1 cut(s) 135
BslI CCNNNNNNNGG 2 cut(s) 230, 362
BsmI GAATGC 1 cut(s) 157
Bsp1286I GDGCHC 1 cut(s) 370
Bsp143I GATC 5 cut(s) 20, 40, 77, 163, 283
BspACI CCGC 6 cut(s) 55, 92, 251, 268, 271, 274
BspCNI CTCAG 2 cut(s) 94, 418
BspLI GGNNCC 1 cut(s) 260
BspPI GGATC 3 cut(s) 28, 85, 171
BsrBI CCGCTC 1 cut(s) 268
BsrDI GCAATG 1 cut(s) 241
BssMI GATC 5 cut(s) 20, 40, 77, 163, 283
BssNI GRCGYC 2 cut(s) 146, 389
Bst4CI ACNGT 3 cut(s) 194, 215, 365
BstACI GRCGYC 2 cut(s) 146, 389
BstDEI CTNAG 2 cut(s) 81, 426
BstHHI GCGC 2 cut(s) 313, 322
BstKTI GATC 5 cut(s) 23, 43, 80, 166, 286
BstMBI GATC 5 cut(s) 20, 40, 77, 163, 283
BstMWI GCNNNNNNNGC 3 cut(s) 98, 317, 319
BstNSI RCATGY 1 cut(s) 326
BstV1I GCAGC 3 cut(s) 133, 182, 320
BstX2I RGATCY 2 cut(s) 77, 163
BstYI RGATCY 2 cut(s) 77, 163
BtsIMutI CAGTG 1 cut(s) 220
CfoI GCGC 2 cut(s) 313, 322
Cfr13I GGNCC 3 cut(s) 63, 259, 348
CseI GACGC 2 cut(s) 135, 378
CviAII CATG 1 cut(s) 323
CviJI RGCY 4 cut(s) 70, 138, 254, 345
CviKI_1 RGCY 4 cut(s) 70, 138, 254, 345
DdeI CTNAG 2 cut(s) 81, 426
DpnI GATC 5 cut(s) 22, 42, 79, 165, 285
DpnII GATC 5 cut(s) 20, 40, 77, 163, 283
EciI GGCGGA 2 cut(s) 70, 289
Eco47I GGWCC 3 cut(s) 63, 259, 348
FaeI CATG 1 cut(s) 326
FaiI YATR 7 cut(s) 143, 324, 341, 353, 419, 421, 432
FatI CATG 1 cut(s) 322
Fnu4HI GCNGC 6 cut(s) 122, 171, 252, 269, 272, 309
Fsp4HI GCNGC 6 cut(s) 122, 171, 252, 269, 272, 309
FspBI CTAG 2 cut(s) 407, 445
GlaI GCGC 2 cut(s) 312, 321
GluI GCNGC 6 cut(s) 122, 171, 252, 269, 272, 309
GsaI CCCAGC 1 cut(s) 258
HapII CCGG 1 cut(s) 135
HgaI GACGC 2 cut(s) 135, 378
HhaI GCGC 2 cut(s) 313, 322
Hin1I GRCGYC 2 cut(s) 146, 389
Hin1II CATG 1 cut(s) 326
Hin6I GCGC 2 cut(s) 311, 320
HinP1I GCGC 2 cut(s) 311, 320
HindIII AAGCTT 1 cut(s) 68
HinfI GANTC 1 cut(s) 434
HpaII CCGG 1 cut(s) 135
HphI GGTGA 3 cut(s) 50, 106, 425
Hpy188I TCNGA 5 cut(s) 8, 45, 163, 263, 427
Hpy188III TCNNGA 2 cut(s) 371, 393
Hpy99I CGWCG 4 cut(s) 151, 194, 250, 284
HpyCH4III ACNGT 3 cut(s) 194, 215, 365
HpyCH4V TGCA 2 cut(s) 101, 170
HpyF10VI GCNNNNNNNGC 3 cut(s) 98, 317, 319
HpyF3I CTNAG 2 cut(s) 81, 426
Hsp92I GRCGYC 2 cut(s) 146, 389
Hsp92II CATG 1 cut(s) 326
HspAI GCGC 2 cut(s) 311, 320
Kzo9I GATC 5 cut(s) 20, 40, 77, 163, 283
LmnI GCTCC 1 cut(s) 276
Lsp1109I GCAGC 3 cut(s) 133, 182, 320
MaeI CTAG 2 cut(s) 407, 445
MaeIII GTNAC 1 cut(s) 94
MalI GATC 5 cut(s) 22, 42, 79, 165, 285
MbiI CCGCTC 1 cut(s) 268
MboI GATC 5 cut(s) 20, 40, 77, 163, 283
MboII GAAGA 1 cut(s) 310
MflI RGATCY 2 cut(s) 77, 163
MhlI GDGCHC 1 cut(s) 370
MluCI AATT 1 cut(s) 225
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 2 cut(s) 101, 178
MseI TTAA 1 cut(s) 180
MspI CCGG 1 cut(s) 135
Mva1269I GAATGC 1 cut(s) 157
MwoI GCNNNNNNNGC 3 cut(s) 98, 317, 319
NdeII GATC 5 cut(s) 20, 40, 77, 163, 283
NlaIII CATG 1 cut(s) 326
NlaIV GGNNCC 1 cut(s) 260
NmuCI GTSAC 1 cut(s) 94
NspI RCATGY 1 cut(s) 326
PctI GAATGC 1 cut(s) 157
PfeI GAWTC 1 cut(s) 434
PflMI CCANNNNNTGG 1 cut(s) 230
PkrI GCNGC 6 cut(s) 123, 172, 253, 270, 273, 310
PspFI CCCAGC 1 cut(s) 254
PspN4I GGNNCC 1 cut(s) 260
PspPI GGNCC 3 cut(s) 63, 259, 348
PsuI RGATCY 2 cut(s) 77, 163
SaqAI TTAA 1 cut(s) 180
SatI GCNGC 6 cut(s) 122, 171, 252, 269, 272, 309
Sau3AI GATC 5 cut(s) 20, 40, 77, 163, 283
Sau96I GGNCC 3 cut(s) 63, 259, 348
SduI GDGCHC 1 cut(s) 370
SetI ASST 1 cut(s) 72
SinI GGWCC 3 cut(s) 63, 259, 348
SmlI CTYRAG 1 cut(s) 369
SmoI CTYRAG 1 cut(s) 369
Sse9I AATT 1 cut(s) 225
SsiI CCGC 6 cut(s) 55, 92, 251, 268, 271, 274
SspMI CTAG 2 cut(s) 407, 445
TaaI ACNGT 3 cut(s) 194, 215, 365
TaqI TCGA 1 cut(s) 245
TasI AATT 1 cut(s) 225
TauI GCSGC 3 cut(s) 254, 271, 274
TfiI GAWTC 1 cut(s) 434
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TscAI CASTG 1 cut(s) 220
TseFI GTSAC 1 cut(s) 94
TseI GCWGC 3 cut(s) 121, 170, 308
Tsp45I GTSAC 1 cut(s) 94
TspRI CASTG 1 cut(s) 220
Van91I CCANNNNNTGG 1 cut(s) 230
VpaK11BI GGWCC 3 cut(s) 63, 259, 348
XceI RCATGY 1 cut(s) 326
XspI CTAG 2 cut(s) 407, 445
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.