Rmu_sc0012670.1_g000004

F-box kelch-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012670.1
OG0012601
Physical Location & Seq
Reverse (-)
11458 .. 11784
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012670.1_g000004.1.cds

Sequence Viewer

Length: 327 bp
atggcgaacaacgaccttcctgaggatatcattgtgaaaattctgaccaggctgcctgtcaagtctttggtccgattccgttgtgtttcgaaacggtggcgttctatactgtccgactcccagtttgccaaatcccatattagactagcctccgagcagaaaaccctcagtcacagactcctcgtctccggctcatctagtcttgaatctttagatttggaaaagccattcggagtcggaaacgagtcttcagtcagagaactcgcctgtccactccagcaatttggggaacgtgtcttgctactggcaatggcttggtgtttatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like FBA_1 FBA_3

Protein Analysis

108

Amino Acids

12.17

Weight (kDa)

9.3

Isoelectric Point (pI)

64.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 39
AcuI CTGAAG 1 cut(s) 234
AfiI CCNNNNNNNGG 1 cut(s) 22
AflIII ACRYGT 1 cut(s) 292
AgsI TTSAA 1 cut(s) 206
AhdI GACNNNNNGTC 1 cut(s) 182
AjnI CCWGG 1 cut(s) 47
Alw26I GTCTC 1 cut(s) 190
ApeKI GCWGC 1 cut(s) 52
ApoI RAATTY 1 cut(s) 39
ArsI GACNNNNNNTTYG 2 cut(s) 107, 139
AspS9I GGNCC 1 cut(s) 70
AsuII TTCGAA 1 cut(s) 89
AvaII GGWCC 1 cut(s) 70
AxyI CCTNAGG 1 cut(s) 21
BbsI GAAGAC 1 cut(s) 240
BbvI GCAGC 1 cut(s) 39
BciT130I CCWGG 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 190
BfaI CTAG 2 cut(s) 146, 198
BisI GCNGC 1 cut(s) 53
BlsI GCNGC 1 cut(s) 54
Bme1390I CCNGG 1 cut(s) 49
Bme18I GGWCC 1 cut(s) 70
BmeRI GACNNNNNGTC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 70
BmrFI CCNGG 1 cut(s) 49
BmrI ACTGGG 1 cut(s) 115
BmuI ACTGGG 1 cut(s) 115
BpiI GAAGAC 1 cut(s) 240
BpmI CTGGAG 1 cut(s) 260
Bpu14I TTCGAA 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse1I ACTGG 2 cut(s) 121, 309
Bse21I CCTNAGG 1 cut(s) 21
Bse3DI GCAATG 1 cut(s) 315
BseBI CCWGG 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 315
BseMII CTCAG 2 cut(s) 12, 181
BseNI ACTGG 2 cut(s) 121, 309
BseRI GAGGAG 1 cut(s) 170
BseXI GCAGC 1 cut(s) 39
BsiSI CCGG 1 cut(s) 189
BslI CCNNNNNNNGG 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 190
BsmBI CGTCTC 1 cut(s) 190
Bsp119I TTCGAA 1 cut(s) 89
BspCNI CTCAG 2 cut(s) 13, 180
BspT104I TTCGAA 1 cut(s) 89
BsrDI GCAATG 1 cut(s) 315
BsrI ACTGG 2 cut(s) 121, 309
Bst2UI CCWGG 1 cut(s) 49
Bst4CI ACNGT 2 cut(s) 96, 111
BstBI TTCGAA 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 21, 167
BstENI CCTNNNNNAGG 1 cut(s) 20
BstMAI GTCTC 1 cut(s) 190
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 1 cut(s) 47
BstV1I GCAGC 1 cut(s) 39
BstV2I GAAGAC 1 cut(s) 240
BstXI CCANNNNNNTGG 1 cut(s) 284
Bsu36I CCTNAGG 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 70
CviJI RGCY 5 cut(s) 52, 149, 192, 226, 314
CviKI_1 RGCY 5 cut(s) 52, 149, 192, 226, 314
DdeI CTNAG 2 cut(s) 21, 167
DriI GACNNNNNGTC 1 cut(s) 182
Eam1105I GACNNNNNGTC 1 cut(s) 182
Eco32I GATATC 1 cut(s) 28
Eco47I GGWCC 1 cut(s) 70
Eco57I CTGAAG 1 cut(s) 234
Eco81I CCTNAGG 1 cut(s) 21
EcoNI CCTNNNNNAGG 1 cut(s) 20
EcoRII CCWGG 1 cut(s) 47
EcoRV GATATC 1 cut(s) 28
Esp3I CGTCTC 1 cut(s) 190
FaiI YATR 3 cut(s) 107, 138, 325
Fnu4HI GCNGC 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 53
FspBI CTAG 2 cut(s) 146, 198
GluI GCNGC 1 cut(s) 53
GsuI CTGGAG 1 cut(s) 260
HapII CCGG 1 cut(s) 189
HinfI GANTC 6 cut(s) 75, 116, 177, 206, 234, 245
HpaII CCGG 1 cut(s) 189
Hpy166II GTNNAC 1 cut(s) 272
Hpy188I TCNGA 7 cut(s) 45, 74, 115, 154, 233, 239, 257
Hpy188III TCNNGA 2 cut(s) 20, 203
Hpy8I GTNNAC 1 cut(s) 272
HpyAV CCTTC 1 cut(s) 26
HpyCH4III ACNGT 2 cut(s) 96, 111
HpyCH4IV ACGT 1 cut(s) 292
HpyF3I CTNAG 2 cut(s) 21, 167
HpySE526I ACGT 1 cut(s) 292
LpnPI CCDG 9 cut(s) 33, 34, 61, 69, 134, 202, 280, 290, 290
Lsp1109I GCAGC 1 cut(s) 39
MaeI CTAG 2 cut(s) 146, 198
MaeII ACGT 1 cut(s) 292
MaeIII GTNAC 1 cut(s) 170
MboII GAAGA 1 cut(s) 240
MluCI AATT 2 cut(s) 39, 281
MlyI GAGTC 4 cut(s) 110, 171, 243, 254
MmeI TCCRAC 2 cut(s) 138, 217
MnlI CCTC 4 cut(s) 16, 160, 176, 191
MspI CCGG 1 cut(s) 189
MspR9I CCNGG 1 cut(s) 49
MvaI CCWGG 1 cut(s) 49
NmuCI GTSAC 1 cut(s) 170
NspV TTCGAA 1 cut(s) 89
PfeI GAWTC 2 cut(s) 75, 206
PkrI GCNGC 1 cut(s) 54
PleI GAGTC 4 cut(s) 110, 171, 242, 253
PpsI GAGTC 4 cut(s) 110, 171, 242, 253
Psp6I CCWGG 1 cut(s) 47
PspGI CCWGG 1 cut(s) 47
PspPI GGNCC 1 cut(s) 70
SatI GCNGC 1 cut(s) 53
Sau96I GGNCC 1 cut(s) 70
SchI GAGTC 4 cut(s) 110, 171, 243, 254
ScrFI CCNGG 1 cut(s) 49
SetI ASST 2 cut(s) 18, 295
SfuI TTCGAA 1 cut(s) 89
SinI GGWCC 1 cut(s) 70
Sse9I AATT 2 cut(s) 39, 281
SspMI CTAG 2 cut(s) 146, 198
StyD4I CCNGG 1 cut(s) 47
TaaI ACNGT 2 cut(s) 96, 111
TaiI ACGT 1 cut(s) 295
TaqI TCGA 1 cut(s) 89
TasI AATT 2 cut(s) 39, 281
TfiI GAWTC 2 cut(s) 75, 206
TseFI GTSAC 1 cut(s) 170
TseI GCWGC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 170
TspGWI ACGGA 1 cut(s) 68
VpaK11BI GGWCC 1 cut(s) 70
XagI CCTNNNNNAGG 1 cut(s) 20
XapI RAATTY 1 cut(s) 39
XspI CTAG 2 cut(s) 146, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.