Rmu_sc0002652.1_g000022

Mediator of RNA polymerase II transcription subunit 15a-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002652.1
Physical Location & Seq
Reverse (-)
59735 .. 66404
6670 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002652.1_g000022.1.cds

Sequence Viewer

Length: 4170 bp
atggacacgaataattggaggcctcctcaaggtggagagcctgcaatggatgcaggagattggaggagccaattacagcaggattcgcggcagagaatcgtcaataagataatggatacattgaagaggcatcttcccttctccggtcaagagggattgcacgaactcaagaaaattgctgttaggtttgaggaaaagatttatactgctgctacaagccagtcggattatctacggaaaatttctctgaaaatgctcactatggagaccaagtctcagaacacaattggcacttctttaccaagcaactctgctggtaatagtaacaggccccctgatccaggatctttcatgcaaccccaagttcccaatcaaggacagtcactccctatgccagtgccagccaatcaatctcaaccacgccaacaactcttatcacagaacattcagaataacattccgcccaattctgctggcttatcatctgcattatctcctgcatctgggctcacccagactcctgtaccgagtattgttggaaatgcaaacttgcaaagtatgtcggggacatcacagaattcattggggaactccatcggccagggggtaacttcaaatatgtttgctaattcccaaaggcaaatgccaggacgacaacaggtagttccgcagcagcaacagcagcaaacccagaattcacagcagtatatgtaccagcaacagttacaacaacagctcatgaagccaaaatttcagcagcagggaaacatccaacttgtgcaaaatcatatgcaacagcaacaacagcagcagcagaacttattgcaatcacctcagttgcaatcttctcagcaatctgttatgcaacctcctgcagtgcagtcgtctctctctagtcttcagcagaatcaacaatctgctatgcaacactcttcacaagccatgcttcagcagcattctcaatctgttctgcggcagcaacagcagcctcaacagtcttctgttgttcatcagcagcaaacaccaatcccacagcagtcaatactgcccccacagcagcagcagcaacagccacagcttatggtgcaacagccaaattcaacaaacttgccgcagaatcagcttattggacaacaaaacaatgtaggggacatgcagcaacagcaacagcaacagcaacagcaacagcaacagcaacagcaacagcaaaggttactaagccagcagaggcttattggacaacaaaacaatgtaggggacatgcagcaacagcaacagcaacagcaacagcaacagcaacagcaacagcaaaggttactaagccagcagaataatatgttaaacttgcaacagcagcagcagcaacaacaacaccaattaatggctcagcaaaacaacctctcaaatatgcatcagcaacagttgggcactcagagtaatgttactggattacagcaacagcagcaccttggtactcaaactggtaactcaagcatgcaaactaatcagcactctgcacacatgctgcaatccaaggttcagcaacaacatcagagtccagcattaccgattcaaggacatcagtcccaacctcaggtgtcacagcaacaattattatcacagattcaatctcagcctgcacagatacaacaacagatgggtatgcaacagcaatcaaaccagctacaacgagatctgcagcaaaggatccaagcatcaggtcaggtatcaggatccatgcttcaaccaccaaatgtaatggatccgcaaaagcagttatatcaagctcaaagagcccttcctgagacgtcatcaacgtctctagattccacagcccagactggacatacaaatggtgctgattggcaagaggaggtctatcaaaagatcaaagtcatgaaggatatgtactaccccgaactaagtgaaatgtaccaaaaaattgctactaaacttcatcagcacgactcccttccacaacagccaaagtcagatcagcttgagaagctgaagatgtttaagaccatgctggagcgcctgataacagtcttacaaatttccaaaactagcataacacctggtttgaaggagaagttgggcttatacgagaagcagataataaattttattaatacaaatagacccaggaagcctgtttcttctctgccgccagggcagctccccccaccgcatatgcagtccatgcagcagtcacaatcccagattactcaagtgcaatctcatgaaaatcagatgaacccacaattgcaatccctgaacttgcaaggttctgtgccaacaatgcagcagaacaatatgacgggcttgcagcaaaattctatgtcttctttatctggggtttcaacagcacagcaaaacatgatgaatccgttgcagccaagttccaatatggatccaggacaaggaaccgcactgaactcactgcagcaggtccctgtgggctctatccaacagactcctgtcagtgctccccaacaagctaacatgaatgccttatcatcacagaatgggattaacatgctgcagagcaacattaatccccttcagtcaaattctggtatgcttcatagccaacatctgaaacagcaggaacagcaattgtatcagaatcaactcaagcaacaacaatttcaacaacgacagatgcagcagcagcagttgatgcagaagcagctaattcaacaacagcagcagcagcaacagcaacagcaacaacagctacaacagcaagcaaagcagcagctgcctggacagttgcaggcacaccaaatgccacagcttcaccaaatcagtgatgttaatgatgtgaaagtaaggccagggatgggtgttaagtcaggggcctttcagcaacaaatgtctgtaggccagcgtgcttatcctcattcgcaattaaaaccgggatctccatatcctatcacatcaagcaaccaactccttcaggctcaatctcctcaactgtcacagcattcttctccacaagttgaccagccgatgttagtcccaaaagctcaaaatgctagctcaccatttgtcatcccatctccttcaactcccatagcgccatcacctatgccaggagattcagagaaaccttcctcactcgcaaatgctgggaatgttggacatcaacaagcaactgttgtcggagctcaggtccagtcccttgccatcggcacccctgggatatcagcctctcctttgcttgctgaatttatcggtccagatggcactcatgctaatgctttgtcagcaatatctggcaagtcaagtgttacagagcaacctcttgaacgcttgattaaagcggtcaagtcaatatcaccaaaggcattaagtgcatctgtcagtgacataggctcagtagtgagtatgattgataggatagcaggttcagcaccaggtaatggatctagagctgcagttggtgaggatctggttgctatgacaaaatgtcgtctacaggcgagaaacttcatcactcatgatggaacaacaaatgggacaaggaaaatgaggcgatacactagtgccatgcccttaaatgttgtgtcatcaggtggcagcatgaatgatagtttcaagcagttgacctgttcagagacatctgacctggagtcaactgcaacgtctcgtatcaaaaggcctaggattgaggctaatcatgctcttatggaagaaataagagaaataaatcggcggcttatagatacagttgttgatatcagtgatgaagatgttgatccaagtgcggctgctgctgaagggggtgaaggaaccatcgtcaagtgctcttttgatgctgtggctctcagtcccaacttgaaatcgcagtatgcttcagcacaaatgtctccgattcagccattaagactgcttgttccgacaaattatcccaactgctctccaatactgttagacaagtttccggttgaagtcagtaaggagtatgaagatctttctgtgaaggcaaaatcaaggtttagcatctctttacgaagcatttcgcagcccatgtcccttggggagatagcaagggcttgggataattgtgcacgtacagttatttctgagcatgcacagcgaagtggtggaggcagcttcagctcaaagtatgggacatgggagaactgcctgagtgccgcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1389

Amino Acids

153.77

Weight (kDa)

9.43

Isoelectric Point (pI)

73.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 1811
Acc36I ACCTGC 2 cut(s) 2440, 3401
AccB1I GGYRCC 1 cut(s) 3197
AccB7I CCANNNNNTGG 2 cut(s) 1381, 3428
AccI GTMKAC 1 cut(s) 3481
AccII CGCG 1 cut(s) 88
AcoI YGGCCR 1 cut(s) 598
AcuI CTGAAG 8 cut(s) 884, 932, 2030, 2549, 2945, 3804, 3846, 4108
AcyI GRCGYC 1 cut(s) 1808
AfaI GTAC 6 cut(s) 525, 713, 1474, 1910, 1934, 4081
AhdI GACNNNNNGTC 2 cut(s) 3474, 3637
AhlI ACTAGT 1 cut(s) 3548
AjuI GAANNNNNNNTTGG 2 cut(s) 2078, 2110
AloI GAACNNNNNNTCC 2 cut(s) 3397, 3429
Alw21I GWGCWC 4 cut(s) 2491, 3175, 3815, 4078
Alw26I GTCTC 8 cut(s) 260, 279, 891, 1799, 1824, 3617, 3657, 3879
Alw44I GTGCAC 1 cut(s) 4074
AlwNI CAGNNNCTG 1 cut(s) 2764
AoxI GGCC 7 cut(s) 20, 329, 598, 2837, 2862, 2887, 3665
ApaLI GTGCAC 1 cut(s) 4074
AseI ATTAAT 3 cut(s) 1379, 2130, 2556
Asp700I GAANNNNTTC 1 cut(s) 4024
AspA2I CCTAGG 1 cut(s) 3668
AspLEI GCGC 2 cut(s) 2037, 3085
AspS9I GGNCC 5 cut(s) 330, 2452, 2862, 3178, 3242
AsuC2I CCSGG 1 cut(s) 2922
AsuHPI GGTGA 8 cut(s) 502, 822, 2795, 3039, 3081, 3336, 3461, 3803
AsuNHI GCTAGC 1 cut(s) 3041
AvaII GGWCC 3 cut(s) 2452, 3178, 3242
AvrII CCTAGG 1 cut(s) 3668
AxyI CCTNAGG 1 cut(s) 1593
BaeGI GKGCMC 2 cut(s) 1430, 4078
BaeI ACNNNNGTAYC 6 cut(s) 507, 540, 3535, 3568, 3723, 3756
BamHI GGATCC 4 cut(s) 1707, 1733, 1762, 2413
BanI GGYRCC 1 cut(s) 3197
BanII GRGCYC 4 cut(s) 510, 1798, 2465, 3175
BarI GAAGNNNNNNTAC 2 cut(s) 1892, 1924
BbsI GAAGAC 3 cut(s) 890, 990, 2337
Bbv12I GWGCWC 4 cut(s) 2491, 3175, 3815, 4078
BccI CCATC 9 cut(s) 602, 1651, 2839, 3070, 3094, 3200, 3242, 3503, 3809
BcgI CGANNNNNNTGC 2 cut(s) 864, 898
BciVI GTATCC 1 cut(s) 109
BcnI CCSGG 1 cut(s) 2922
BcoDI GTCTC 8 cut(s) 260, 279, 891, 1799, 1824, 3617, 3657, 3879
BcuI ACTAGT 1 cut(s) 3548
BfaI CTAG 7 cut(s) 894, 1823, 2067, 3042, 3435, 3549, 3669
BfmI CTRYAG 7 cut(s) 873, 1697, 2444, 2543, 2883, 3441, 3482
BfoI RGCGCY 2 cut(s) 2038, 3086
BfuAI ACCTGC 2 cut(s) 2440, 3401
BfuI GTATCC 1 cut(s) 109
BglI GCCNNNNNGGC 1 cut(s) 2173
BglII AGATCT 2 cut(s) 1693, 3976
BlnI CCTAGG 1 cut(s) 3668
BlpI GCTNAGC 1 cut(s) 1386
Bme18I GGWCC 3 cut(s) 2452, 3178, 3242
BmeRI GACNNNNNGTC 2 cut(s) 3474, 3637
BmgT120I GGNCC 5 cut(s) 330, 2452, 2862, 3178, 3242
BmtI GCTAGC 1 cut(s) 3045
BoxI GACNNNNGTC 2 cut(s) 1582, 2480
BpiI GAAGAC 3 cut(s) 890, 990, 2337
BplI GAGNNNNNCTC 2 cut(s) 10, 42
BpmI CTGGAG 2 cut(s) 2051, 3656
Bpu10I CCTNAGC 1 cut(s) 3174
Bpu1102I GCTNAGC 1 cut(s) 1386
BpuEI CTTGAG 6 cut(s) 12, 152, 1474, 2021, 2214, 2621
BpuMI CCSGG 1 cut(s) 2922
BsaAI YACGTR 1 cut(s) 4079
BsaBI GATNNNNATC 1 cut(s) 3762
BsaHI GRCGYC 1 cut(s) 1808
BsaI GGTCTC 1 cut(s) 260
BsaWI WCCGGW 2 cut(s) 143, 3949
BsaXI ACNNNNNCTCC 8 cut(s) 257, 287, 369, 399, 502, 532, 3162, 3192
Bse1I ACTGG 6 cut(s) 220, 395, 1450, 1486, 1846, 3181
Bse21I CCTNAGG 1 cut(s) 1593
Bse3DI GCAATG 1 cut(s) 51
Bse8I GATNNNNATC 1 cut(s) 3762
BseGI GGATG 4 cut(s) 55, 768, 2850, 3057
BseJI GATNNNNATC 1 cut(s) 3762
BseMI GCAATG 1 cut(s) 51
BseNI ACTGG 6 cut(s) 220, 395, 1450, 1486, 1846, 3181
BseRI GAGGAG 4 cut(s) 15, 79, 1886, 2964
BseSI GKGCMC 2 cut(s) 1430, 4078
BseYI CCCAGC 1 cut(s) 3134
BsgI GTGCAG 3 cut(s) 899, 1500, 1623
Bsh1236I CGCG 1 cut(s) 88
BshFI GGCC 7 cut(s) 22, 331, 600, 2839, 2864, 2889, 3667
BshNI GGYRCC 1 cut(s) 3197
BsiHKAI GWGCWC 4 cut(s) 2491, 3175, 3815, 4078
BsiSI CCGG 3 cut(s) 144, 2921, 3950
BsmAI GTCTC 8 cut(s) 260, 279, 891, 1799, 1824, 3617, 3657, 3879
BsmBI CGTCTC 4 cut(s) 891, 1799, 1824, 3657
BsmI GAATGC 3 cut(s) 955, 2515, 2989
BsnI GGCC 7 cut(s) 22, 331, 600, 2839, 2864, 2889, 3667
Bso31I GGTCTC 1 cut(s) 260
Bsp1286I GDGCHC 8 cut(s) 510, 1430, 1798, 2465, 2491, 3175, 3815, 4078
Bsp1720I GCTNAGC 1 cut(s) 1386
BspANI GGCC 7 cut(s) 22, 331, 600, 2839, 2864, 2889, 3667
BspFNI CGCG 1 cut(s) 88
BspHI TCATGA 4 cut(s) 738, 1896, 2242, 3505
BspMAI CTGCAG 5 cut(s) 877, 1701, 2448, 2547, 3445
BspMI ACCTGC 2 cut(s) 2440, 3401
BspOI GCTAGC 1 cut(s) 3045
BspT107I GGYRCC 1 cut(s) 3197
BspTNI GGTCTC 1 cut(s) 260
BsrDI GCAATG 1 cut(s) 51
BsrI ACTGG 6 cut(s) 220, 395, 1450, 1486, 1846, 3181
BssNI GRCGYC 1 cut(s) 1808
BssT1I CCWWGG 4 cut(s) 1468, 1533, 3668, 4042
Bst6I CTCTTC 2 cut(s) 119, 937
BstACI GRCGYC 1 cut(s) 1808
BstAPI GCANNNNNTGC 5 cut(s) 50, 2203, 2683, 2764, 3359
BstBAI YACGTR 1 cut(s) 4079
BstENI CCTNNNNNAGG 3 cut(s) 27, 339, 3096
BstF5I GGATG 4 cut(s) 55, 768, 2850, 3057
BstFNI CGCG 1 cut(s) 88
BstH2I RGCGCY 2 cut(s) 2038, 3086
BstHHI GCGC 2 cut(s) 2037, 3085
BstMAI GTCTC 8 cut(s) 260, 279, 891, 1799, 1824, 3617, 3657, 3879
BstNSI RCATGY 6 cut(s) 1156, 1264, 1498, 1525, 2542, 4100
BstPAI GACNNNNGTC 2 cut(s) 1582, 2480
BstSFI CTRYAG 7 cut(s) 873, 1697, 2444, 2543, 2883, 3441, 3482
BstSLI GKGCMC 2 cut(s) 1430, 4078
BstUI CGCG 1 cut(s) 88
BstV2I GAAGAC 3 cut(s) 890, 990, 2337
Bsu36I CCTNAGG 1 cut(s) 1593
BsuI GTATCC 1 cut(s) 109
BsuRI GGCC 7 cut(s) 22, 331, 600, 2839, 2864, 2889, 3667
BtsCI GGATG 4 cut(s) 55, 768, 2850, 3057
BtsI GCAGTG 2 cut(s) 882, 2441
BtsIMutI CAGTG 8 cut(s) 402, 882, 2432, 2441, 2491, 2818, 3376, 3754
BveI ACCTGC 2 cut(s) 2440, 3401
CaiI CAGNNNCTG 1 cut(s) 2764
CciI TCATGA 4 cut(s) 738, 1896, 2242, 3505
CfoI GCGC 2 cut(s) 2037, 3085
Cfr13I GGNCC 5 cut(s) 330, 2452, 2862, 3178, 3242
CsiI ACCWGGT 2 cut(s) 2077, 3421
Csp6I GTAC 6 cut(s) 524, 712, 1473, 1909, 1933, 4080
CviQI GTAC 6 cut(s) 524, 712, 1473, 1909, 1933, 4080
DriI GACNNNNNGTC 2 cut(s) 3474, 3637
EaeI YGGCCR 1 cut(s) 598
Eam1104I CTCTTC 2 cut(s) 119, 937
Eam1105I GACNNNNNGTC 2 cut(s) 3474, 3637
EarI CTCTTC 2 cut(s) 119, 937
EciI GGCGGA 1 cut(s) 450
Ecl136II GAGCTC 1 cut(s) 3173
Eco130I CCWWGG 4 cut(s) 1468, 1533, 3668, 4042
Eco147I AGGCCT 2 cut(s) 22, 3667
Eco24I GRGCYC 4 cut(s) 510, 1798, 2465, 3175
Eco31I GGTCTC 1 cut(s) 260
Eco32I GATATC 2 cut(s) 3210, 3745
Eco47I GGWCC 3 cut(s) 2452, 3178, 3242
Eco53kI GAGCTC 1 cut(s) 3173
Eco57I CTGAAG 8 cut(s) 884, 932, 2030, 2549, 2945, 3804, 3846, 4108
Eco81I CCTNAGG 1 cut(s) 1593
EcoICRI GAGCTC 1 cut(s) 3173
EcoNI CCTNNNNNAGG 3 cut(s) 27, 339, 3096
EcoO109I RGGNCCY 3 cut(s) 330, 2452, 2862
EcoRI GAATTC 2 cut(s) 577, 694
EcoRV GATATC 2 cut(s) 3210, 3745
EcoT14I CCWWGG 4 cut(s) 1468, 1533, 3668, 4042
EcoT22I ATGCAT 1 cut(s) 1413
EcoT38I GRGCYC 4 cut(s) 510, 1798, 2465, 3175
ErhI CCWWGG 4 cut(s) 1468, 1533, 3668, 4042
Esp3I CGTCTC 4 cut(s) 891, 1799, 1824, 3657
FalI AAGNNNNNCTT 4 cut(s) 930, 962, 2084, 2116
FauNDI CATATG 2 cut(s) 789, 2193
FblI GTMKAC 1 cut(s) 3481
FokI GGATG 4 cut(s) 62, 755, 2857, 3044
FriOI GRGCYC 4 cut(s) 510, 1798, 2465, 3175
FspBI CTAG 7 cut(s) 894, 1823, 2067, 3042, 3435, 3549, 3669
GlaI GCGC 2 cut(s) 2036, 3084
GsaI CCCAGC 1 cut(s) 3138
GsuI CTGGAG 2 cut(s) 2051, 3656
HaeII RGCGCY 2 cut(s) 2038, 3086
HaeIII GGCC 7 cut(s) 22, 331, 600, 2839, 2864, 2889, 3667
HapII CCGG 3 cut(s) 144, 2921, 3950
HhaI GCGC 2 cut(s) 2037, 3085
Hin1I GRCGYC 1 cut(s) 1808
Hin6I GCGC 2 cut(s) 2035, 3083
HinP1I GCGC 2 cut(s) 2035, 3083
HincII GTYRAC 3 cut(s) 3007, 3612, 3642
HindII GTYRAC 3 cut(s) 3007, 3612, 3642
HpaII CCGG 3 cut(s) 144, 2921, 3950
HphI GGTGA 8 cut(s) 502, 822, 2795, 3039, 3081, 3336, 3461, 3803
Hpy166II GTNNAC 5 cut(s) 3007, 3482, 3612, 3642, 4076
Hpy8I GTNNAC 5 cut(s) 3007, 3482, 3612, 3642, 4076
HpyCH4IV ACGT 4 cut(s) 1808, 1817, 3650, 4078
HpySE526I ACGT 4 cut(s) 1808, 1817, 3650, 4078
Hsp92I GRCGYC 1 cut(s) 1808
HspAI GCGC 2 cut(s) 2035, 3083
LmnI GCTCC 5 cut(s) 66, 2032, 2184, 2494, 3170
MabI ACCWGGT 2 cut(s) 2077, 3421
MaeI CTAG 7 cut(s) 894, 1823, 2067, 3042, 3435, 3549, 3669
MaeII ACGT 4 cut(s) 1808, 1817, 3650, 4078
MfeI CAATTG 3 cut(s) 285, 2264, 2618
MhlI GDGCHC 8 cut(s) 510, 1430, 1798, 2465, 2491, 3175, 3815, 4078
MlyI GAGTC 5 cut(s) 511, 1564, 1961, 2470, 3647
MmeI TCCRAC 7 cut(s) 204, 517, 796, 2494, 3124, 3148, 3929
Mph1103I ATGCAT 1 cut(s) 1413
MroXI GAANNNNTTC 1 cut(s) 4024
MslI CAYNNNNRTG 2 cut(s) 1851, 3261
MspA1I CMGCKG 1 cut(s) 2764
MspI CCGG 3 cut(s) 144, 2921, 3950
MunI CAATTG 3 cut(s) 285, 2264, 2618
Mva1269I GAATGC 3 cut(s) 955, 2515, 2989
MvnI CGCG 1 cut(s) 88
NciI CCSGG 1 cut(s) 2922
NdeI CATATG 2 cut(s) 789, 2193
NheI GCTAGC 1 cut(s) 3041
NmuCI GTSAC 5 cut(s) 381, 1599, 2211, 2982, 3371
NsiI ATGCAT 1 cut(s) 1413
NspI RCATGY 6 cut(s) 1156, 1264, 1498, 1525, 2542, 4100
PaeI GCATGC 2 cut(s) 1498, 4100
PagI TCATGA 4 cut(s) 738, 1896, 2242, 3505
PasI CCCWGGG 1 cut(s) 3203
PceI AGGCCT 2 cut(s) 22, 3667
PcsI WCGNNNNNNNCGW 1 cut(s) 1814
PctI GAATGC 3 cut(s) 955, 2515, 2989
PdmI GAANNNNTTC 1 cut(s) 4024
PflFI GACNNNGTC 1 cut(s) 271
PflMI CCANNNNNTGG 2 cut(s) 1381, 3428
PfoI TCCNGGA 2 cut(s) 340, 2416
PleI GAGTC 5 cut(s) 511, 1563, 1961, 2470, 3646
PpsI GAGTC 5 cut(s) 511, 1563, 1961, 2470, 3646
Ppu21I YACGTR 1 cut(s) 4079
PpuMI RGGWCCY 1 cut(s) 2452
PshAI GACNNNNGTC 2 cut(s) 1582, 2480
PshBI ATTAAT 3 cut(s) 1379, 2130, 2556
Psp124BI GAGCTC 1 cut(s) 3175
Psp5II RGGWCCY 1 cut(s) 2452
PspFI CCCAGC 1 cut(s) 3134
PspPI GGNCC 5 cut(s) 330, 2452, 2862, 3178, 3242
PspPPI RGGWCCY 1 cut(s) 2452
PstI CTGCAG 5 cut(s) 877, 1701, 2448, 2547, 3445
PstNI CAGNNNCTG 1 cut(s) 2764
PsyI GACNNNGTC 1 cut(s) 271
PvuII CAGCTG 1 cut(s) 2764
RsaI GTAC 6 cut(s) 525, 713, 1474, 1910, 1934, 4081
RsaNI GTAC 6 cut(s) 524, 712, 1473, 1909, 1933, 4080
RseI CAYNNNNRTG 2 cut(s) 1851, 3261
SacI GAGCTC 1 cut(s) 3175
Sau96I GGNCC 5 cut(s) 330, 2452, 2862, 3178, 3242
SchI GAGTC 5 cut(s) 511, 1564, 1961, 2470, 3647
SduI GDGCHC 8 cut(s) 510, 1430, 1798, 2465, 2491, 3175, 3815, 4078
SexAI ACCWGGT 2 cut(s) 2077, 3421
SfcI CTRYAG 7 cut(s) 873, 1697, 2444, 2543, 2883, 3441, 3482
SinI GGWCC 3 cut(s) 2452, 3178, 3242
SmiMI CAYNNNNRTG 2 cut(s) 1851, 3261
SmlI CTYRAG 6 cut(s) 27, 167, 1489, 2000, 2229, 2636
SmoI CTYRAG 6 cut(s) 27, 167, 1489, 2000, 2229, 2636
SpeI ACTAGT 1 cut(s) 3548
SphI GCATGC 2 cut(s) 1498, 4100
SseBI AGGCCT 2 cut(s) 22, 3667
SspMI CTAG 7 cut(s) 894, 1823, 2067, 3042, 3435, 3549, 3669
SstI GAGCTC 1 cut(s) 3175
StuI AGGCCT 2 cut(s) 22, 3667
StyI CCWWGG 4 cut(s) 1468, 1533, 3668, 4042
TaiI ACGT 4 cut(s) 1811, 1820, 3653, 4081
TaqII GACCGA 1 cut(s) 3230
TatI WGTACW 1 cut(s) 1908
TauI GCSGC 7 cut(s) 91, 976, 1114, 2170, 3724, 3776, 4166
TscAI CASTG 8 cut(s) 402, 882, 2439, 2448, 2491, 2818, 3376, 3754
TseFI GTSAC 5 cut(s) 381, 1599, 2211, 2982, 3371
Tsp45I GTSAC 5 cut(s) 381, 1599, 2211, 2982, 3371
TspGWI ACGGA 2 cut(s) 250, 2379
TspRI CASTG 8 cut(s) 402, 882, 2439, 2448, 2491, 2818, 3376, 3754
Tth111I GACNNNGTC 1 cut(s) 271
Van91I CCANNNNNTGG 2 cut(s) 1381, 3428
VneI GTGCAC 1 cut(s) 4074
VpaK11BI GGWCC 3 cut(s) 2452, 3178, 3242
VspI ATTAAT 3 cut(s) 1379, 2130, 2556
XagI CCTNNNNNAGG 3 cut(s) 27, 339, 3096
XbaI TCTAGA 2 cut(s) 1822, 3434
XceI RCATGY 6 cut(s) 1156, 1264, 1498, 1525, 2542, 4100
XmaJI CCTAGG 1 cut(s) 3668
XmiI GTMKAC 1 cut(s) 3481
XmnI GAANNNNTTC 1 cut(s) 4024
XspI CTAG 7 cut(s) 894, 1823, 2067, 3042, 3435, 3549, 3669
ZraI GACGTC 1 cut(s) 1809
Zsp2I ATGCAT 1 cut(s) 1413
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.