Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002847.1

Orthogroup ID

OG0006914

Physical Location & Seq

Genomic Coordinates Reverse (-)

1888 .. 3775

Gene Structure 1888 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002847.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1014 bp

atgtttgtgttcggaagctctctggtggataatggcaacaataacttcttggaaaccgagtcgaaatccgattacttgccgtatggaatcgacttcccaaatggaacttctgggagattcacaaatggtaaaaatgttattgatctccttggtgatcagcttaagctacccttcattccaccatttcaagacccctccactaaaggaagtaaaattgttcatggtgtcaaccatgcctctggctctactggtatcttagatgatacaggattagttctgggtaatgaaccgagcttgagtcaacaagtcaaggacttcgaggctgtgacactggcagagttagaagcagagctagggtgcaatagctctcaatctctacaaagctacttgattgttgtaggagttggtgggaatgattacatgctcaactatttccttaggaaattgtacctccgaatcagtattgaaaccttcactgcaaatctcatagactctctagctcagaaactccaggaattgtacaatttgggaggtcgtacattcgtgttaacgtcactaatgccattaggctacagtcctgtgattaacaggccaagtcctattggcaccgaatcagctctgaatcaggcggctcagctctacaacgctcacttgaatacattgctcgactctctcaaaactcacttatccgacttcaatttcgttttggttaaccaatataacattatatctaatctcacttattctcctccttccactacaggctttaaagacataagcaacccttgttgtacagtttccctctctcaaggtgcctacctttcaggtggaattggaatatcatgcgatagaggtgggaaggcatgtgaagataggacggcttatatgtattttgatgggttacatccaacagaagctgtaaatgttcaaatagcaaccaaggcatatgcttctactcaacagggcgaggattacccaatcaatgtcagccaacttgcccagcttcaaagttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lipase_GDSL

Protein Analysis

337

Amino Acids

36.51

Weight (kDa)

4.76

Isoelectric Point (pI)

40.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006914)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g12400
malus_domestica	MD05G1039300.v1.1
prunus_persica	Prupe.8G051800_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0272471 RchiOBHm_Chr6g0272551
rosa_laevigata	RLG00000013667
rosa_multiflora	Rmu_sc0002847.1_g000001 Rmu_sc0002847.1_g000006 Rmu_sc0003080.1_g000018 Rmu_sc0004003.1_g000020 Rmu_sc0004904.1_g000002
rosa_roxburghii	Rroxscaffold_7G00196160
rosa_rugosa	Rorug06G0069900 Rorug06G0069900 Rorug06G0070000
rosa_samantha	Rh6AG185600 Rh6AG186300 Rh6BG188700 Rh6BG189000 Rh6BG189400 Rh6CG186800 Rh6CG187200 Rh6DG178400 Rh6DG178900
rosa_wichuraiana	Rw0G015690 Rw6G016050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	605, 812
AciI	CCGC	1 cut(s)	629
AfaI	GTAC	4 cut(s)	449, 521, 538, 793
AflII	CTTAAG	1 cut(s)	161
AgsI	TTSAA	6 cut(s)	188, 467, 655, 697, 929, 1007
AjnI	CCWGG	1 cut(s)	510
AjuI	GAANNNNNNNTTGG	2 cut(s)	91, 123
AlwNI	CAGNNNCTG	1 cut(s)	917
AoxI	GGCC	1 cut(s)	590
ArsI	GACNNNNNNTTYG	2 cut(s)	683, 715
AsuHPI	GGTGA	1 cut(s)	164
AxyI	CCTNAGG	1 cut(s)	437
BanI	GGYRCC	2 cut(s)	605, 812
BccI	CCATC	1 cut(s)	890
BceAI	ACGGC	2 cut(s)	64, 894
BciT130I	CCWGG	1 cut(s)	512
BclI	TGATCA	1 cut(s)	154
BfaI	CTAG	2 cut(s)	353, 497
BfmI	CTRYAG	2 cut(s)	571, 759
BfrI	CTTAAG	1 cut(s)	161
BisI	GCNGC	1 cut(s)	630
BlpI	GCTNAGC	1 cut(s)	633
BlsI	GCNGC	1 cut(s)	631
Bme1390I	CCNGG	1 cut(s)	512
BmiI	GGNNCC	2 cut(s)	607, 814
BmrFI	CCNGG	1 cut(s)	512
BpmI	CTGGAG	1 cut(s)	494
Bpu1102I	GCTNAGC	1 cut(s)	633
BpuEI	CTTGAG	2 cut(s)	316, 792
BsaJI	CCNNGG	2 cut(s)	148, 939
BsaXI	ACNNNNNCTCC	2 cut(s)	730, 760
Bse1I	ACTGG	2 cut(s)	253, 336
Bse21I	CCTNAGG	1 cut(s)	437
Bse3DI	GCAATG	1 cut(s)	659
BseBI	CCWGG	1 cut(s)	512
BseDI	CCNNGG	2 cut(s)	148, 939
BseGI	GGATG	1 cut(s)	904
BseMI	GCAATG	1 cut(s)	659
BseMII	CTCAG	2 cut(s)	515, 647
BseNI	ACTGG	2 cut(s)	253, 336
BseRI	GAGGAG	1 cut(s)	738
BseYI	CCCAGC	1 cut(s)	999
BshFI	GGCC	1 cut(s)	592
BshNI	GGYRCC	2 cut(s)	605, 812
BsnI	GGCC	1 cut(s)	592
Bsp1407I	TGTACA	2 cut(s)	519, 791
Bsp143I	GATC	2 cut(s)	142, 154
Bsp1720I	GCTNAGC	1 cut(s)	633
BspACI	CCGC	1 cut(s)	629
BspANI	GGCC	1 cut(s)	592
BspCNI	CTCAG	2 cut(s)	514, 646
BspLI	GGNNCC	2 cut(s)	607, 814
BspT107I	GGYRCC	2 cut(s)	605, 812
BspTI	CTTAAG	1 cut(s)	161
BsrDI	GCAATG	1 cut(s)	659
BsrGI	TGTACA	2 cut(s)	519, 791
BsrI	ACTGG	2 cut(s)	253, 336
BssECI	CCNNGG	2 cut(s)	148, 939
BssMI	GATC	2 cut(s)	142, 154
BssT1I	CCWWGG	2 cut(s)	148, 939
Bst2UI	CCWGG	1 cut(s)	512
Bst4CI	ACNGT	2 cut(s)	575, 796
BstAFI	CTTAAG	1 cut(s)	161
BstAUI	TGTACA	2 cut(s)	519, 791
BstDEI	CTNAG	4 cut(s)	256, 437, 501, 633
BstF5I	GGATG	1 cut(s)	904
BstKTI	GATC	2 cut(s)	145, 157
BstMBI	GATC	2 cut(s)	142, 154
BstMWI	GCNNNNNNNGC	1 cut(s)	941
BstNI	CCWGG	1 cut(s)	512
BstNSI	RCATGY	2 cut(s)	424, 867
BstSCI	CCNGG	1 cut(s)	510
BstSFI	CTRYAG	2 cut(s)	571, 759
BstXI	CCANNNNNNTGG	1 cut(s)	239
Bsu36I	CCTNAGG	1 cut(s)	437
BsuRI	GGCC	1 cut(s)	592
BtsCI	GGATG	1 cut(s)	904
BtsI	GCAGTG	1 cut(s)	474
BtsIMutI	CAGTG	2 cut(s)	329, 474
CaiI	CAGNNNCTG	1 cut(s)	917
Csp6I	GTAC	4 cut(s)	448, 520, 537, 792
CviAII	CATG	5 cut(s)	221, 233, 421, 843, 864
CviQI	GTAC	4 cut(s)	448, 520, 537, 792
DdeI	CTNAG	4 cut(s)	256, 437, 501, 633
DpnI	GATC	2 cut(s)	144, 156
DpnII	GATC	2 cut(s)	142, 154
DraI	TTTAAA	1 cut(s)	769
Eco130I	CCWWGG	2 cut(s)	148, 939
Eco81I	CCTNAGG	1 cut(s)	437
EcoRII	CCWGG	1 cut(s)	510
EcoT14I	CCWWGG	2 cut(s)	148, 939
ErhI	CCWWGG	2 cut(s)	148, 939
FaeI	CATG	5 cut(s)	224, 236, 424, 846, 867
FalI	AAGNNNNNCTT	4 cut(s)	155, 187, 769, 801
FatI	CATG	5 cut(s)	220, 232, 420, 842, 863
FauNDI	CATATG	1 cut(s)	946
FbaI	TGATCA	1 cut(s)	154
Fnu4HI	GCNGC	1 cut(s)	630
FokI	GGATG	1 cut(s)	891
Fsp4HI	GCNGC	1 cut(s)	630
FspBI	CTAG	2 cut(s)	353, 497
GluI	GCNGC	1 cut(s)	630
GsaI	CCCAGC	1 cut(s)	1003
GsuI	CTGGAG	1 cut(s)	494
HaeIII	GGCC	1 cut(s)	592
Hin1II	CATG	5 cut(s)	224, 236, 424, 846, 867
HincII	GTYRAC	4 cut(s)	229, 302, 549, 712
HindII	GTYRAC	4 cut(s)	229, 302, 549, 712
HinfI	GANTC	9 cut(s)	59, 87, 117, 298, 456, 491, 611, 622, 668
HpaI	GTTAAC	2 cut(s)	549, 712
HphI	GGTGA	1 cut(s)	164
Hpy166II	GTNNAC	4 cut(s)	229, 302, 549, 712
Hpy188I	TCNGA	6 cut(s)	14, 70, 455, 504, 621, 691
Hpy188III	TCNNGA	1 cut(s)	188
Hpy8I	GTNNAC	4 cut(s)	229, 302, 549, 712
HpyAV	CCTTC	4 cut(s)	181, 481, 762, 853
HpyCH4III	ACNGT	2 cut(s)	575, 796
HpyCH4IV	ACGT	1 cut(s)	551
HpyCH4V	TGCA	2 cut(s)	360, 479
HpyF10VI	GCNNNNNNNGC	1 cut(s)	941
HpyF3I	CTNAG	4 cut(s)	256, 437, 501, 633
HpySE526I	ACGT	1 cut(s)	551
Hsp92II	CATG	5 cut(s)	224, 236, 424, 846, 867
Ksp22I	TGATCA	1 cut(s)	154
KspAI	GTTAAC	2 cut(s)	549, 712
Kzo9I	GATC	2 cut(s)	142, 154
MaeI	CTAG	2 cut(s)	353, 497
MaeII	ACGT	1 cut(s)	551
MaeIII	GTNAC	3 cut(s)	325, 552, 900
MalI	GATC	2 cut(s)	144, 156
MboI	GATC	2 cut(s)	142, 154
MboII	GAAGA	1 cut(s)	881
MluCI	AATT	6 cut(s)	213, 443, 515, 523, 697, 831
MlyI	GAGTC	4 cut(s)	68, 307, 485, 662
MmeI	TCCRAC	2 cut(s)	714, 932
MnlI	CCTC	9 cut(s)	205, 247, 313, 461, 524, 759, 812, 845, 961
MseI	TTAA	6 cut(s)	162, 548, 585, 711, 768, 1012
MspCI	CTTAAG	1 cut(s)	161
MspR9I	CCNGG	1 cut(s)	512
MvaI	CCWGG	1 cut(s)	512
MwoI	GCNNNNNNNGC	1 cut(s)	941
NdeI	CATATG	1 cut(s)	946
NdeII	GATC	2 cut(s)	142, 154
NlaIII	CATG	5 cut(s)	224, 236, 424, 846, 867
NlaIV	GGNNCC	2 cut(s)	607, 814
NmuCI	GTSAC	2 cut(s)	325, 552
NspI	RCATGY	2 cut(s)	424, 867
PfeI	GAWTC	5 cut(s)	87, 117, 456, 611, 622
PfoI	TCCNGGA	1 cut(s)	510
PkrI	GCNGC	1 cut(s)	631
PleI	GAGTC	4 cut(s)	67, 306, 485, 662
PpsI	GAGTC	4 cut(s)	67, 306, 485, 662
Psp6I	CCWGG	1 cut(s)	510
PspFI	CCCAGC	1 cut(s)	999
PspGI	CCWGG	1 cut(s)	510
PspN4I	GGNNCC	2 cut(s)	607, 814
PstNI	CAGNNNCTG	1 cut(s)	917
RsaI	GTAC	4 cut(s)	449, 521, 538, 793
RsaNI	GTAC	4 cut(s)	448, 520, 537, 792
SaqAI	TTAA	6 cut(s)	162, 548, 585, 711, 768, 1012
SatI	GCNGC	1 cut(s)	630
Sau3AI	GATC	2 cut(s)	142, 154
SchI	GAGTC	4 cut(s)	68, 307, 485, 662
ScrFI	CCNGG	1 cut(s)	512
SfcI	CTRYAG	2 cut(s)	571, 759
SmlI	CTYRAG	3 cut(s)	161, 295, 807
SmoI	CTYRAG	3 cut(s)	161, 295, 807
Sse9I	AATT	6 cut(s)	213, 443, 515, 523, 697, 831
SsiI	CCGC	1 cut(s)	629
SspMI	CTAG	2 cut(s)	353, 497
StyD4I	CCNGG	1 cut(s)	510
StyI	CCWWGG	2 cut(s)	148, 939
TaaI	ACNGT	2 cut(s)	575, 796
TaiI	ACGT	1 cut(s)	554
TaqI	TCGA	4 cut(s)	62, 90, 318, 666
TasI	AATT	6 cut(s)	213, 443, 515, 523, 697, 831
TatI	WGTACW	2 cut(s)	519, 791
TauI	GCSGC	1 cut(s)	632
TfiI	GAWTC	5 cut(s)	87, 117, 456, 611, 622
Tru1I	TTAA	6 cut(s)	162, 548, 585, 711, 768, 1012
Tru9I	TTAA	6 cut(s)	162, 548, 585, 711, 768, 1012
TscAI	CASTG	2 cut(s)	336, 481
TseFI	GTSAC	2 cut(s)	325, 552
Tsp45I	GTSAC	2 cut(s)	325, 552
TspDTI	ATGAA	3 cut(s)	163, 209, 300
TspRI	CASTG	2 cut(s)	336, 481
Vha464I	CTTAAG	1 cut(s)	161
XceI	RCATGY	2 cut(s)	424, 867
XspI	CTAG	2 cut(s)	353, 497

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.