Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002847.1

Orthogroup ID

OG0006914

Physical Location & Seq

Genomic Coordinates Reverse (-)

40199 .. 43625

Gene Structure 3427 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002847.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 879 bp

atggcagaagacgagaccgccgcaataacactaccacatatggaagaagaacaagatgtaacaatcgtgcaaccaccggggaaagaagaagaggaggatgcatccctaatccgacccgaatccggagaagaaaacgcattccgaaccgaatcagacacagcaactatccaagcagtattggaagaagaggaaccacagatcggagaagaagaggaaccaccgatggctgaagaagacgacgcagccacgacccaatccgaatccggtgaagagaacgcagtcggtccaaccccgacaccgacagcatccaccgccgccaccaccacagcagcccctcccaggagtcttggaagaggtaatgcaacgagcttgagtcaacaagttaaggacttcgaggttgtgacactggcagagttagaagcagagctagggtgcaatagctctcaatctctaccaagctacttgattgttgtaggagttggtgggaatgattacatgctcaactatttccttaggaaattgtacctccgaatcagtcttgaaaccttcactgcaaatctcatcgactctctagctcagaaactccaggaattgtacattttgggaggtcgtaaattcgtgttaacgtcgctaatgccattaggctacagtcctgtgattaacaggccaaatcatattggcaccccatcagctctgaattacgcagctcagctctacaacgctaacttgaagacattgctcgactctctgaaagctcacttatccgacttcaatttcgttttggttgaccaatataacattatatctaatctcacttattctcctccttccactacaggtacttttagtatcactagtattagttctttaaaattttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lipase_GDSL

Protein Analysis

292

Amino Acids

31.69

Weight (kDa)

4.22

Isoelectric Point (pI)

58.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006914)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g12400
malus_domestica	MD05G1039300.v1.1
prunus_persica	Prupe.8G051800_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0272471 RchiOBHm_Chr6g0272551
rosa_laevigata	RLG00000013667
rosa_multiflora	Rmu_sc0002847.1_g000001 Rmu_sc0002847.1_g000006 Rmu_sc0003080.1_g000018 Rmu_sc0004003.1_g000020 Rmu_sc0004904.1_g000002
rosa_roxburghii	Rroxscaffold_7G00196160
rosa_rugosa	Rorug06G0069900 Rorug06G0069900 Rorug06G0070000
rosa_samantha	Rh6AG185600 Rh6AG186300 Rh6BG188700 Rh6BG189000 Rh6BG189400 Rh6CG186800 Rh6CG187200 Rh6DG178400 Rh6DG178900
rosa_wichuraiana	Rw0G015690 Rw6G016050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	680
AccIII	TCCGGA	1 cut(s)	122
AciI	CCGC	4 cut(s)	18, 21, 312, 315
AcsI	RAATTY	2 cut(s)	614, 872
AcuI	CTGAAG	1 cut(s)	249
AfaI	GTAC	3 cut(s)	524, 596, 841
AfiI	CCNNNNNNNGG	3 cut(s)	122, 200, 339
AgsI	TTSAA	3 cut(s)	542, 730, 772
AhlI	ACTAGT	1 cut(s)	854
AjnI	CCWGG	2 cut(s)	338, 585
AluBI	AGCT	9 cut(s)	369, 427, 441, 459, 575, 692, 707, 712, 755
AluI	AGCT	9 cut(s)	369, 427, 441, 459, 575, 692, 707, 712, 755
Alw26I	GTCTC	1 cut(s)	8
Aor13HI	TCCGGA	1 cut(s)	122
AoxI	GGCC	1 cut(s)	665
ApeKI	GCWGC	3 cut(s)	242, 329, 704
ApoI	RAATTY	2 cut(s)	614, 872
ArsI	GACNNNNNNTTYG	2 cut(s)	758, 790
AspS9I	GGNCC	1 cut(s)	284
AsuC2I	CCSGG	1 cut(s)	78
AsuHPI	GGTGA	1 cut(s)	278
AvaII	GGWCC	1 cut(s)	284
AxyI	CCTNAGG	1 cut(s)	512
BanI	GGYRCC	1 cut(s)	680
BbsI	GAAGAC	3 cut(s)	15, 240, 737
BbvI	GCAGC	3 cut(s)	254, 341, 716
BccI	CCATC	2 cut(s)	217, 694
BciT130I	CCWGG	2 cut(s)	340, 587
BcnI	CCSGG	1 cut(s)	78
BcoDI	GTCTC	1 cut(s)	8
BcuI	ACTAGT	1 cut(s)	854
BfaI	CTAG	3 cut(s)	428, 572, 855
BfmI	CTRYAG	2 cut(s)	646, 834
BisI	GCNGC	5 cut(s)	21, 243, 315, 330, 705
BlpI	GCTNAGC	1 cut(s)	708
BlsI	GCNGC	5 cut(s)	22, 244, 316, 331, 706
Bme1390I	CCNGG	3 cut(s)	78, 340, 587
Bme18I	GGWCC	1 cut(s)	284
BmgT120I	GGNCC	1 cut(s)	284
BmiI	GGNNCC	3 cut(s)	192, 216, 682
BmrFI	CCNGG	3 cut(s)	78, 340, 587
BmsI	GCATC	3 cut(s)	88, 110, 314
BpiI	GAAGAC	3 cut(s)	15, 240, 737
BpmI	CTGGAG	1 cut(s)	569
Bpu1102I	GCTNAGC	1 cut(s)	708
BpuEI	CTTGAG	1 cut(s)	391
BpuMI	CCSGG	1 cut(s)	78
BsaI	GGTCTC	1 cut(s)	8
BsaJI	CCNNGG	2 cut(s)	77, 338
BsaWI	WCCGGW	2 cut(s)	122, 263
BsaXI	ACNNNNNCTCC	2 cut(s)	805, 835
Bsc4I	CCNNNNNNNGG	3 cut(s)	122, 200, 339
Bse1I	ACTGG	1 cut(s)	411
Bse21I	CCTNAGG	1 cut(s)	512
Bse3DI	GCAATG	1 cut(s)	734
BseAI	TCCGGA	1 cut(s)	122
BseBI	CCWGG	2 cut(s)	340, 587
BseDI	CCNNGG	2 cut(s)	77, 338
BseGI	GGATG	3 cut(s)	101, 103, 305
BseLI	CCNNNNNNNGG	3 cut(s)	122, 200, 339
BseMI	GCAATG	1 cut(s)	734
BseMII	CTCAG	2 cut(s)	590, 722
BseNI	ACTGG	1 cut(s)	411
BseRI	GAGGAG	2 cut(s)	107, 813
BseXI	GCAGC	3 cut(s)	254, 341, 716
BshFI	GGCC	1 cut(s)	667
BshNI	GGYRCC	1 cut(s)	680
BsiSI	CCGG	3 cut(s)	77, 123, 264
BslI	CCNNNNNNNGG	3 cut(s)	122, 200, 339
BsmAI	GTCTC	1 cut(s)	8
BsmI	GAATGC	1 cut(s)	137
BsnI	GGCC	1 cut(s)	667
Bso31I	GGTCTC	1 cut(s)	8
Bsp13I	TCCGGA	1 cut(s)	122
Bsp1407I	TGTACA	1 cut(s)	594
Bsp143I	GATC	1 cut(s)	198
Bsp1720I	GCTNAGC	1 cut(s)	708
BspACI	CCGC	4 cut(s)	18, 21, 312, 315
BspANI	GGCC	1 cut(s)	667
BspCNI	CTCAG	2 cut(s)	589, 721
BspEI	TCCGGA	1 cut(s)	122
BspLI	GGNNCC	3 cut(s)	192, 216, 682
BspT107I	GGYRCC	1 cut(s)	680
BspTNI	GGTCTC	1 cut(s)	8
BsrDI	GCAATG	1 cut(s)	734
BsrGI	TGTACA	1 cut(s)	594
BsrI	ACTGG	1 cut(s)	411
BssECI	CCNNGG	2 cut(s)	77, 338
BssMI	GATC	1 cut(s)	198
Bst2UI	CCWGG	2 cut(s)	340, 587
Bst4CI	ACNGT	1 cut(s)	650
Bst6I	CTCTTC	5 cut(s)	84, 180, 204, 264, 346
BstAUI	TGTACA	1 cut(s)	594
BstDEI	CTNAG	3 cut(s)	512, 576, 708
BstF5I	GGATG	3 cut(s)	101, 103, 305
BstKTI	GATC	1 cut(s)	201
BstMAI	GTCTC	1 cut(s)	8
BstMBI	GATC	1 cut(s)	198
BstMWI	GCNNNNNNNGC	1 cut(s)	311
BstNI	CCWGG	2 cut(s)	340, 587
BstNSI	RCATGY	1 cut(s)	499
BstSCI	CCNGG	3 cut(s)	76, 338, 585
BstSFI	CTRYAG	2 cut(s)	646, 834
BstV1I	GCAGC	3 cut(s)	254, 341, 716
BstV2I	GAAGAC	3 cut(s)	15, 240, 737
Bsu36I	CCTNAGG	1 cut(s)	512
BsuRI	GGCC	1 cut(s)	667
BtsCI	GGATG	3 cut(s)	101, 103, 305
BtsI	GCAGTG	1 cut(s)	549
BtsIMutI	CAGTG	2 cut(s)	404, 549
Cfr13I	GGNCC	1 cut(s)	284
CseI	GACGC	1 cut(s)	248
Csp6I	GTAC	3 cut(s)	523, 595, 840
CviAII	CATG	1 cut(s)	496
CviQI	GTAC	3 cut(s)	523, 595, 840
DdeI	CTNAG	3 cut(s)	512, 576, 708
DpnI	GATC	1 cut(s)	200
DpnII	GATC	1 cut(s)	198
DraI	TTTAAA	1 cut(s)	870
Eam1104I	CTCTTC	5 cut(s)	84, 180, 204, 264, 346
EarI	CTCTTC	5 cut(s)	84, 180, 204, 264, 346
Eco31I	GGTCTC	1 cut(s)	8
Eco47I	GGWCC	1 cut(s)	284
Eco57I	CTGAAG	1 cut(s)	249
Eco81I	CCTNAGG	1 cut(s)	512
EcoRII	CCWGG	2 cut(s)	338, 585
EcoT22I	ATGCAT	1 cut(s)	103
FaeI	CATG	1 cut(s)	499
FaiI	YATR	6 cut(s)	39, 41, 497, 675, 795, 803
FatI	CATG	1 cut(s)	495
FauNDI	CATATG	1 cut(s)	39
Fnu4HI	GCNGC	5 cut(s)	21, 243, 315, 330, 705
FokI	GGATG	3 cut(s)	88, 110, 292
Fsp4HI	GCNGC	5 cut(s)	21, 243, 315, 330, 705
FspBI	CTAG	3 cut(s)	428, 572, 855
GluI	GCNGC	5 cut(s)	21, 243, 315, 330, 705
GsuI	CTGGAG	1 cut(s)	569
HaeIII	GGCC	1 cut(s)	667
HapII	CCGG	3 cut(s)	77, 123, 264
HgaI	GACGC	1 cut(s)	248
Hin1II	CATG	1 cut(s)	499
HincII	GTYRAC	3 cut(s)	377, 624, 787
HindII	GTYRAC	3 cut(s)	377, 624, 787
HinfI	GANTC	8 cut(s)	119, 149, 260, 343, 373, 531, 566, 743
HpaI	GTTAAC	1 cut(s)	624
HpaII	CCGG	3 cut(s)	77, 123, 264
HphI	GGTGA	1 cut(s)	278
Hpy166II	GTNNAC	3 cut(s)	377, 624, 787
Hpy188III	TCNNGA	2 cut(s)	123, 539
Hpy8I	GTNNAC	3 cut(s)	377, 624, 787
Hpy99I	CGWCG	2 cut(s)	242, 631
HpyAV	CCTTC	2 cut(s)	556, 837
HpyCH4III	ACNGT	1 cut(s)	650
HpyCH4IV	ACGT	1 cut(s)	626
HpyCH4V	TGCA	5 cut(s)	70, 101, 362, 435, 554
HpyF10VI	GCNNNNNNNGC	1 cut(s)	311
HpyF3I	CTNAG	3 cut(s)	512, 576, 708
HpySE526I	ACGT	1 cut(s)	626
Hsp92II	CATG	1 cut(s)	499
Kpn2I	TCCGGA	1 cut(s)	122
KspAI	GTTAAC	1 cut(s)	624
Kzo9I	GATC	1 cut(s)	198
Lsp1109I	GCAGC	3 cut(s)	254, 341, 716
LweI	GCATC	3 cut(s)	88, 110, 314
MaeI	CTAG	3 cut(s)	428, 572, 855
MaeII	ACGT	1 cut(s)	626
MaeIII	GTNAC	2 cut(s)	58, 400
MalI	GATC	1 cut(s)	200
MboI	GATC	1 cut(s)	198
MluCI	AATT	6 cut(s)	518, 590, 614, 697, 772, 872
MlyI	GAGTC	4 cut(s)	352, 382, 560, 737
MmeI	TCCRAC	3 cut(s)	136, 311, 789
Mph1103I	ATGCAT	1 cut(s)	103
MroI	TCCGGA	1 cut(s)	122
MseI	TTAA	4 cut(s)	384, 623, 660, 869
MspI	CCGG	3 cut(s)	77, 123, 264
MspR9I	CCNGG	3 cut(s)	78, 340, 587
Mva1269I	GAATGC	1 cut(s)	137
MvaI	CCWGG	2 cut(s)	340, 587
MwoI	GCNNNNNNNGC	1 cut(s)	311
NciI	CCSGG	1 cut(s)	78
NdeI	CATATG	1 cut(s)	39
NdeII	GATC	1 cut(s)	198
NlaIII	CATG	1 cut(s)	499
NlaIV	GGNNCC	3 cut(s)	192, 216, 682
NmuCI	GTSAC	1 cut(s)	400
NsiI	ATGCAT	1 cut(s)	103
NspI	RCATGY	1 cut(s)	499
PctI	GAATGC	1 cut(s)	137
PfeI	GAWTC	4 cut(s)	119, 149, 260, 531
PfoI	TCCNGGA	1 cut(s)	585
PkrI	GCNGC	5 cut(s)	22, 244, 316, 331, 706
PleI	GAGTC	4 cut(s)	351, 381, 560, 737
PpsI	GAGTC	4 cut(s)	351, 381, 560, 737
Psp6I	CCWGG	2 cut(s)	338, 585
PspGI	CCWGG	2 cut(s)	338, 585
PspN4I	GGNNCC	3 cut(s)	192, 216, 682
PspPI	GGNCC	1 cut(s)	284
RsaI	GTAC	3 cut(s)	524, 596, 841
RsaNI	GTAC	3 cut(s)	523, 595, 840
SaqAI	TTAA	4 cut(s)	384, 623, 660, 869
SatI	GCNGC	5 cut(s)	21, 243, 315, 330, 705
Sau3AI	GATC	1 cut(s)	198
Sau96I	GGNCC	1 cut(s)	284
SchI	GAGTC	4 cut(s)	352, 382, 560, 737
ScrFI	CCNGG	3 cut(s)	78, 340, 587
SfaNI	GCATC	3 cut(s)	88, 110, 314
SfcI	CTRYAG	2 cut(s)	646, 834
SinI	GGWCC	1 cut(s)	284
SmlI	CTYRAG	1 cut(s)	370
SmoI	CTYRAG	1 cut(s)	370
SpeI	ACTAGT	1 cut(s)	854
Sse9I	AATT	6 cut(s)	518, 590, 614, 697, 772, 872
SsiI	CCGC	4 cut(s)	18, 21, 312, 315
SspMI	CTAG	3 cut(s)	428, 572, 855
StyD4I	CCNGG	3 cut(s)	76, 338, 585
TaaI	ACNGT	1 cut(s)	650
TaiI	ACGT	1 cut(s)	629
TaqI	TCGA	3 cut(s)	393, 564, 741
TaqII	GACCGA	1 cut(s)	272
TasI	AATT	6 cut(s)	518, 590, 614, 697, 772, 872
TatI	WGTACW	1 cut(s)	594
TauI	GCSGC	2 cut(s)	23, 317
TfiI	GAWTC	4 cut(s)	119, 149, 260, 531
Tru1I	TTAA	4 cut(s)	384, 623, 660, 869
Tru9I	TTAA	4 cut(s)	384, 623, 660, 869
TscAI	CASTG	2 cut(s)	411, 556
TseFI	GTSAC	1 cut(s)	400
TseI	GCWGC	3 cut(s)	242, 329, 704
Tsp45I	GTSAC	1 cut(s)	400
TspRI	CASTG	2 cut(s)	411, 556
VpaK11BI	GGWCC	1 cut(s)	284
XapI	RAATTY	2 cut(s)	614, 872
XceI	RCATGY	1 cut(s)	499
XspI	CTAG	3 cut(s)	428, 572, 855
Zsp2I	ATGCAT	1 cut(s)	103

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.