Rmu_sc0002847.1_g000001

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002847.1
OG0006914
Physical Location & Seq
Reverse (-)
1888 .. 3775
1888 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1014 bp
atgtttgtgttcggaagctctctggtggataatggcaacaataacttcttggaaaccgagtcgaaatccgattacttgccgtatggaatcgacttcccaaatggaacttctgggagattcacaaatggtaaaaatgttattgatctccttggtgatcagcttaagctacccttcattccaccatttcaagacccctccactaaaggaagtaaaattgttcatggtgtcaaccatgcctctggctctactggtatcttagatgatacaggattagttctgggtaatgaaccgagcttgagtcaacaagtcaaggacttcgaggctgtgacactggcagagttagaagcagagctagggtgcaatagctctcaatctctacaaagctacttgattgttgtaggagttggtgggaatgattacatgctcaactatttccttaggaaattgtacctccgaatcagtattgaaaccttcactgcaaatctcatagactctctagctcagaaactccaggaattgtacaatttgggaggtcgtacattcgtgttaacgtcactaatgccattaggctacagtcctgtgattaacaggccaagtcctattggcaccgaatcagctctgaatcaggcggctcagctctacaacgctcacttgaatacattgctcgactctctcaaaactcacttatccgacttcaatttcgttttggttaaccaatataacattatatctaatctcacttattctcctccttccactacaggctttaaagacataagcaacccttgttgtacagtttccctctctcaaggtgcctacctttcaggtggaattggaatatcatgcgatagaggtgggaaggcatgtgaagataggacggcttatatgtattttgatgggttacatccaacagaagctgtaaatgttcaaatagcaaccaaggcatatgcttctactcaacagggcgaggattacccaatcaatgtcagccaacttgcccagcttcaaagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

337

Amino Acids

36.51

Weight (kDa)

4.76

Isoelectric Point (pI)

40.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lipase_GDSL PF00657 2 - 312 2.7e-25 GDSL-like Lipase/Acylhydrolase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 605, 812
AciI CCGC 1 cut(s) 629
AfaI GTAC 4 cut(s) 449, 521, 538, 793
AflII CTTAAG 1 cut(s) 161
AgsI TTSAA 6 cut(s) 188, 467, 655, 697, 929, 1007
AjnI CCWGG 1 cut(s) 510
AjuI GAANNNNNNNTTGG 2 cut(s) 91, 123
AlwNI CAGNNNCTG 1 cut(s) 917
AoxI GGCC 1 cut(s) 590
ArsI GACNNNNNNTTYG 2 cut(s) 683, 715
AsuHPI GGTGA 1 cut(s) 164
AxyI CCTNAGG 1 cut(s) 437
BanI GGYRCC 2 cut(s) 605, 812
BccI CCATC 1 cut(s) 890
BceAI ACGGC 2 cut(s) 64, 894
BciT130I CCWGG 1 cut(s) 512
BclI TGATCA 1 cut(s) 154
BfaI CTAG 2 cut(s) 353, 497
BfmI CTRYAG 2 cut(s) 571, 759
BfrI CTTAAG 1 cut(s) 161
BisI GCNGC 1 cut(s) 630
BlpI GCTNAGC 1 cut(s) 633
BlsI GCNGC 1 cut(s) 631
Bme1390I CCNGG 1 cut(s) 512
BmiI GGNNCC 2 cut(s) 607, 814
BmrFI CCNGG 1 cut(s) 512
BpmI CTGGAG 1 cut(s) 494
Bpu1102I GCTNAGC 1 cut(s) 633
BpuEI CTTGAG 2 cut(s) 316, 792
BsaJI CCNNGG 2 cut(s) 148, 939
BsaXI ACNNNNNCTCC 2 cut(s) 730, 760
Bse1I ACTGG 2 cut(s) 253, 336
Bse21I CCTNAGG 1 cut(s) 437
Bse3DI GCAATG 1 cut(s) 659
BseBI CCWGG 1 cut(s) 512
BseDI CCNNGG 2 cut(s) 148, 939
BseGI GGATG 1 cut(s) 904
BseMI GCAATG 1 cut(s) 659
BseMII CTCAG 2 cut(s) 515, 647
BseNI ACTGG 2 cut(s) 253, 336
BseRI GAGGAG 1 cut(s) 738
BseYI CCCAGC 1 cut(s) 999
BshFI GGCC 1 cut(s) 592
BshNI GGYRCC 2 cut(s) 605, 812
BsnI GGCC 1 cut(s) 592
Bsp1407I TGTACA 2 cut(s) 519, 791
Bsp143I GATC 2 cut(s) 142, 154
Bsp1720I GCTNAGC 1 cut(s) 633
BspACI CCGC 1 cut(s) 629
BspANI GGCC 1 cut(s) 592
BspCNI CTCAG 2 cut(s) 514, 646
BspLI GGNNCC 2 cut(s) 607, 814
BspT107I GGYRCC 2 cut(s) 605, 812
BspTI CTTAAG 1 cut(s) 161
BsrDI GCAATG 1 cut(s) 659
BsrGI TGTACA 2 cut(s) 519, 791
BsrI ACTGG 2 cut(s) 253, 336
BssECI CCNNGG 2 cut(s) 148, 939
BssMI GATC 2 cut(s) 142, 154
BssT1I CCWWGG 2 cut(s) 148, 939
Bst2UI CCWGG 1 cut(s) 512
Bst4CI ACNGT 2 cut(s) 575, 796
BstAFI CTTAAG 1 cut(s) 161
BstAUI TGTACA 2 cut(s) 519, 791
BstDEI CTNAG 4 cut(s) 256, 437, 501, 633
BstF5I GGATG 1 cut(s) 904
BstKTI GATC 2 cut(s) 145, 157
BstMBI GATC 2 cut(s) 142, 154
BstMWI GCNNNNNNNGC 1 cut(s) 941
BstNI CCWGG 1 cut(s) 512
BstNSI RCATGY 2 cut(s) 424, 867
BstSCI CCNGG 1 cut(s) 510
BstSFI CTRYAG 2 cut(s) 571, 759
BstXI CCANNNNNNTGG 1 cut(s) 239
Bsu36I CCTNAGG 1 cut(s) 437
BsuRI GGCC 1 cut(s) 592
BtsCI GGATG 1 cut(s) 904
BtsI GCAGTG 1 cut(s) 474
BtsIMutI CAGTG 2 cut(s) 329, 474
CaiI CAGNNNCTG 1 cut(s) 917
Csp6I GTAC 4 cut(s) 448, 520, 537, 792
CviAII CATG 5 cut(s) 221, 233, 421, 843, 864
CviQI GTAC 4 cut(s) 448, 520, 537, 792
DdeI CTNAG 4 cut(s) 256, 437, 501, 633
DpnI GATC 2 cut(s) 144, 156
DpnII GATC 2 cut(s) 142, 154
DraI TTTAAA 1 cut(s) 769
Eco130I CCWWGG 2 cut(s) 148, 939
Eco81I CCTNAGG 1 cut(s) 437
EcoRII CCWGG 1 cut(s) 510
EcoT14I CCWWGG 2 cut(s) 148, 939
ErhI CCWWGG 2 cut(s) 148, 939
FaeI CATG 5 cut(s) 224, 236, 424, 846, 867
FalI AAGNNNNNCTT 4 cut(s) 155, 187, 769, 801
FatI CATG 5 cut(s) 220, 232, 420, 842, 863
FauNDI CATATG 1 cut(s) 946
FbaI TGATCA 1 cut(s) 154
Fnu4HI GCNGC 1 cut(s) 630
FokI GGATG 1 cut(s) 891
Fsp4HI GCNGC 1 cut(s) 630
FspBI CTAG 2 cut(s) 353, 497
GluI GCNGC 1 cut(s) 630
GsaI CCCAGC 1 cut(s) 1003
GsuI CTGGAG 1 cut(s) 494
HaeIII GGCC 1 cut(s) 592
Hin1II CATG 5 cut(s) 224, 236, 424, 846, 867
HincII GTYRAC 4 cut(s) 229, 302, 549, 712
HindII GTYRAC 4 cut(s) 229, 302, 549, 712
HinfI GANTC 9 cut(s) 59, 87, 117, 298, 456, 491, 611, 622, 668
HpaI GTTAAC 2 cut(s) 549, 712
HphI GGTGA 1 cut(s) 164
Hpy166II GTNNAC 4 cut(s) 229, 302, 549, 712
Hpy188I TCNGA 6 cut(s) 14, 70, 455, 504, 621, 691
Hpy188III TCNNGA 1 cut(s) 188
Hpy8I GTNNAC 4 cut(s) 229, 302, 549, 712
HpyAV CCTTC 4 cut(s) 181, 481, 762, 853
HpyCH4III ACNGT 2 cut(s) 575, 796
HpyCH4IV ACGT 1 cut(s) 551
HpyCH4V TGCA 2 cut(s) 360, 479
HpyF10VI GCNNNNNNNGC 1 cut(s) 941
HpyF3I CTNAG 4 cut(s) 256, 437, 501, 633
HpySE526I ACGT 1 cut(s) 551
Hsp92II CATG 5 cut(s) 224, 236, 424, 846, 867
Ksp22I TGATCA 1 cut(s) 154
KspAI GTTAAC 2 cut(s) 549, 712
Kzo9I GATC 2 cut(s) 142, 154
MaeI CTAG 2 cut(s) 353, 497
MaeII ACGT 1 cut(s) 551
MaeIII GTNAC 3 cut(s) 325, 552, 900
MalI GATC 2 cut(s) 144, 156
MboI GATC 2 cut(s) 142, 154
MboII GAAGA 1 cut(s) 881
MluCI AATT 6 cut(s) 213, 443, 515, 523, 697, 831
MlyI GAGTC 4 cut(s) 68, 307, 485, 662
MmeI TCCRAC 2 cut(s) 714, 932
MnlI CCTC 9 cut(s) 205, 247, 313, 461, 524, 759, 812, 845, 961
MseI TTAA 6 cut(s) 162, 548, 585, 711, 768, 1012
MspCI CTTAAG 1 cut(s) 161
MspR9I CCNGG 1 cut(s) 512
MvaI CCWGG 1 cut(s) 512
MwoI GCNNNNNNNGC 1 cut(s) 941
NdeI CATATG 1 cut(s) 946
NdeII GATC 2 cut(s) 142, 154
NlaIII CATG 5 cut(s) 224, 236, 424, 846, 867
NlaIV GGNNCC 2 cut(s) 607, 814
NmuCI GTSAC 2 cut(s) 325, 552
NspI RCATGY 2 cut(s) 424, 867
PfeI GAWTC 5 cut(s) 87, 117, 456, 611, 622
PfoI TCCNGGA 1 cut(s) 510
PkrI GCNGC 1 cut(s) 631
PleI GAGTC 4 cut(s) 67, 306, 485, 662
PpsI GAGTC 4 cut(s) 67, 306, 485, 662
Psp6I CCWGG 1 cut(s) 510
PspFI CCCAGC 1 cut(s) 999
PspGI CCWGG 1 cut(s) 510
PspN4I GGNNCC 2 cut(s) 607, 814
PstNI CAGNNNCTG 1 cut(s) 917
RsaI GTAC 4 cut(s) 449, 521, 538, 793
RsaNI GTAC 4 cut(s) 448, 520, 537, 792
SaqAI TTAA 6 cut(s) 162, 548, 585, 711, 768, 1012
SatI GCNGC 1 cut(s) 630
Sau3AI GATC 2 cut(s) 142, 154
SchI GAGTC 4 cut(s) 68, 307, 485, 662
ScrFI CCNGG 1 cut(s) 512
SfcI CTRYAG 2 cut(s) 571, 759
SmlI CTYRAG 3 cut(s) 161, 295, 807
SmoI CTYRAG 3 cut(s) 161, 295, 807
Sse9I AATT 6 cut(s) 213, 443, 515, 523, 697, 831
SsiI CCGC 1 cut(s) 629
SspMI CTAG 2 cut(s) 353, 497
StyD4I CCNGG 1 cut(s) 510
StyI CCWWGG 2 cut(s) 148, 939
TaaI ACNGT 2 cut(s) 575, 796
TaiI ACGT 1 cut(s) 554
TaqI TCGA 4 cut(s) 62, 90, 318, 666
TasI AATT 6 cut(s) 213, 443, 515, 523, 697, 831
TatI WGTACW 2 cut(s) 519, 791
TauI GCSGC 1 cut(s) 632
TfiI GAWTC 5 cut(s) 87, 117, 456, 611, 622
Tru1I TTAA 6 cut(s) 162, 548, 585, 711, 768, 1012
Tru9I TTAA 6 cut(s) 162, 548, 585, 711, 768, 1012
TscAI CASTG 2 cut(s) 336, 481
TseFI GTSAC 2 cut(s) 325, 552
Tsp45I GTSAC 2 cut(s) 325, 552
TspDTI ATGAA 3 cut(s) 163, 209, 300
TspRI CASTG 2 cut(s) 336, 481
Vha464I CTTAAG 1 cut(s) 161
XceI RCATGY 2 cut(s) 424, 867
XspI CTAG 2 cut(s) 353, 497
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.