Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003130.1

Orthogroup ID

OG0009555

Physical Location & Seq

Genomic Coordinates Forward (+)

91560 .. 94116

Gene Structure 2557 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003130.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 801 bp

atgttattctcattcgtcgtttctcctttgcaaaaacccaaccccttcaccttctccccaatttcactgcccaaacccaccctcaagctctcaagggcgtcgcaaagtcgatcgcttttcttcggaaatgaggaggacaccgccggaatttcaactgacctcgacgacttgtccccaaacggcgtcgttcaccggaaaacattggcattggttgagtgctccatgtttgctgcgcttactgggttggtgtatttcctcagcaattctctcgcaattgagaattactttggttgcttcttttcgctgcccatagtgatcacctcaatgagatggggcaccgcagctggaagaaaaactatggtggcaacgactatgctattacttgtcttgtctggtccggtgaaagccttaacctatttgcttaagcatggattagttggctttacaatgggaagtttgtggaggtcgggagcaaattggactatttcagttttcttgtgcgcaattgttcgagcattgggttctgtagggtatgttttgatcacctctttcttgatcagagaaaacatatttgctctgatcaccataaacattcatgcttctctaacattcatcttcacagcagcaggcatctatacagttccatcgatggaagcaatatatgccttatttagtattctggtttttataaatagtgggtccttcacgttcttgctgcacatactgtatggtgccttcctttcgaggctcgggatgaaagcatctttgagattgccaagatggctggagaaggcaatatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF2232

Protein Analysis

266

Amino Acids

29.16

Weight (kDa)

9.71

Isoelectric Point (pI)

39.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009555)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G26180 AT1G26180
fragaria_vesca	FvH4_4g28590 FvH4_4g28590
malus_domestica	MD13G1052300.v1.1 MD16G1057600.v1.1
prunus_persica	Prupe.1G299800_v2.0.a1
pyrus_communis	pycom03g00020 pycom13g04660 pycom16g05040
rosa_chinensis	RchiOBHm_Chr4g0436681
rosa_laevigata	RLG00000006504
rosa_multiflora	Rmu_sc0003130.1_g000020 Rmu_sc0007889.1_g000001
rosa_roxburghii	Rroxscaffold_5G00377760
rosa_rugosa	Rorug04G0295200
rosa_samantha	Rh4AG040800 Rh4AG349700 Rh4BG358400 Rh4CG372800 Rh4DG352600
rosa_wichuraiana	Rw4G030590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	689
Acc16I	TGCGCA	1 cut(s)	502
AccB1I	GGYRCC	2 cut(s)	335, 731
AciI	CCGC	2 cut(s)	141, 339
AcsI	RAATTY	1 cut(s)	147
AcyI	GRCGYC	2 cut(s)	98, 183
AflII	CTTAAG	1 cut(s)	422
AgsI	TTSAA	1 cut(s)	153
AhdI	GACNNNNNGTC	1 cut(s)	169
AluBI	AGCT	2 cut(s)	88, 344
AluI	AGCT	2 cut(s)	88, 344
Alw21I	GWGCWC	1 cut(s)	221
Ama87I	CYCGRG	1 cut(s)	749
ApeKI	GCWGC	5 cut(s)	230, 304, 341, 623, 715
ApoI	RAATTY	1 cut(s)	147
AspLEI	GCGC	2 cut(s)	235, 503
AspS9I	GGNCC	2 cut(s)	395, 699
AsuHPI	GGTGA	6 cut(s)	40, 182, 310, 412, 535, 574
AvaI	CYCGRG	1 cut(s)	749
AvaII	GGWCC	2 cut(s)	395, 699
BaeGI	GKGCMC	1 cut(s)	338
BanI	GGYRCC	2 cut(s)	335, 731
BarI	GAAGNNNNNNTAC	2 cut(s)	719, 751
Bbv12I	GWGCWC	1 cut(s)	221
BbvCI	CCTCAGC	1 cut(s)	257
BbvI	GCAGC	5 cut(s)	217, 291, 353, 635, 702
BccI	CCATC	4 cut(s)	324, 643, 652, 774
BceAI	ACGGC	1 cut(s)	196
BcgI	CGANNNNNNTGC	2 cut(s)	250, 284
BclI	TGATCA	4 cut(s)	315, 540, 555, 579
BfmI	CTRYAG	1 cut(s)	525
BfrI	CTTAAG	1 cut(s)	422
BglI	GCCNNNNNGGC	1 cut(s)	781
BisI	GCNGC	5 cut(s)	231, 305, 342, 624, 716
BlsI	GCNGC	5 cut(s)	232, 306, 343, 625, 717
Bme18I	GGWCC	2 cut(s)	395, 699
BmeRI	GACNNNNNGTC	1 cut(s)	169
BmeT110I	CYCGRG	1 cut(s)	749
BmgT120I	GGNCC	2 cut(s)	395, 699
BmiI	GGNNCC	3 cut(s)	337, 700, 733
BmrI	ACTGGG	1 cut(s)	249
BmsI	GCATC	2 cut(s)	639, 770
BmuI	ACTGGG	1 cut(s)	249
Bpu10I	CCTNAGC	1 cut(s)	257
BpuEI	CTTGAG	2 cut(s)	68, 76
Bsa29I	ATCGAT	1 cut(s)	647
BsaHI	GRCGYC	2 cut(s)	98, 183
BsaWI	WCCGGW	2 cut(s)	192, 397
Bse1I	ACTGG	1 cut(s)	244
BseCI	ATCGAT	1 cut(s)	647
BseGI	GGATG	1 cut(s)	759
BseMII	CTCAG	1 cut(s)	271
BseNI	ACTGG	1 cut(s)	244
BseRI	GAGGAG	1 cut(s)	146
BseSI	GKGCMC	1 cut(s)	338
BseXI	GCAGC	5 cut(s)	217, 291, 353, 635, 702
BsgI	GTGCAG	1 cut(s)	701
Bsh1285I	CGRYCG	1 cut(s)	113
BshNI	GGYRCC	2 cut(s)	335, 731
BshVI	ATCGAT	1 cut(s)	647
BsiEI	CGRYCG	1 cut(s)	113
BsiHKAI	GWGCWC	1 cut(s)	221
BsiHKCI	CYCGRG	1 cut(s)	749
BsiSI	CCGG	3 cut(s)	144, 193, 398
BslFI	GGGAC	1 cut(s)	157
BsmFI	GGGAC	1 cut(s)	157
BsoBI	CYCGRG	1 cut(s)	749
Bsp1286I	GDGCHC	2 cut(s)	221, 338
Bsp143I	GATC	5 cut(s)	110, 315, 540, 555, 579
BspACI	CCGC	2 cut(s)	141, 339
BspCNI	CTCAG	1 cut(s)	270
BspDI	ATCGAT	1 cut(s)	647
BspLI	GGNNCC	3 cut(s)	337, 700, 733
BspT107I	GGYRCC	2 cut(s)	335, 731
BspTI	CTTAAG	1 cut(s)	422
BsrI	ACTGG	1 cut(s)	244
BssMI	GATC	5 cut(s)	110, 315, 540, 555, 579
BssNI	GRCGYC	2 cut(s)	98, 183
Bst4CI	ACNGT	2 cut(s)	640, 726
BstACI	GRCGYC	2 cut(s)	98, 183
BstAFI	CTTAAG	1 cut(s)	422
BstAPI	GCANNNNNTGC	1 cut(s)	662
BstC8I	GCNNGC	1 cut(s)	628
BstDEI	CTNAG	1 cut(s)	257
BstF5I	GGATG	1 cut(s)	759
BstHHI	GCGC	2 cut(s)	235, 503
BstKTI	GATC	5 cut(s)	113, 318, 543, 558, 582
BstMBI	GATC	5 cut(s)	110, 315, 540, 555, 579
BstMCI	CGRYCG	1 cut(s)	113
BstMWI	GCNNNNNNNGC	2 cut(s)	662, 781
BstSFI	CTRYAG	1 cut(s)	525
BstSLI	GKGCMC	1 cut(s)	338
BstV1I	GCAGC	5 cut(s)	217, 291, 353, 635, 702
Bsu15I	ATCGAT	1 cut(s)	647
BsuTUI	ATCGAT	1 cut(s)	647
BtsCI	GGATG	1 cut(s)	759
BtsI	GCAGTG	1 cut(s)	65
BtsIMutI	CAGTG	1 cut(s)	65
Cac8I	GCNNGC	1 cut(s)	628
CfoI	GCGC	2 cut(s)	235, 503
Cfr13I	GGNCC	2 cut(s)	395, 699
ClaI	ATCGAT	1 cut(s)	647
CseI	GACGC	2 cut(s)	87, 172
CviAII	CATG	3 cut(s)	223, 428, 596
CviJI	RGCY	6 cut(s)	88, 344, 407, 441, 748, 784
CviKI_1	RGCY	6 cut(s)	88, 344, 407, 441, 748, 784
DdeI	CTNAG	1 cut(s)	257
DpnI	GATC	5 cut(s)	112, 317, 542, 557, 581
DpnII	GATC	5 cut(s)	110, 315, 540, 555, 579
DriI	GACNNNNNGTC	1 cut(s)	169
Eam1105I	GACNNNNNGTC	1 cut(s)	169
Eco47I	GGWCC	2 cut(s)	395, 699
Eco88I	CYCGRG	1 cut(s)	749
EcoO109I	RGGNCCY	1 cut(s)	699
FaeI	CATG	3 cut(s)	226, 431, 599
FaqI	GGGAC	1 cut(s)	157
FatI	CATG	3 cut(s)	222, 427, 595
FbaI	TGATCA	4 cut(s)	315, 540, 555, 579
Fnu4HI	GCNGC	5 cut(s)	231, 305, 342, 624, 716
FokI	GGATG	1 cut(s)	766
Fsp4HI	GCNGC	5 cut(s)	231, 305, 342, 624, 716
FspI	TGCGCA	1 cut(s)	502
GlaI	GCGC	2 cut(s)	234, 502
GluI	GCNGC	5 cut(s)	231, 305, 342, 624, 716
HapII	CCGG	3 cut(s)	144, 193, 398
HgaI	GACGC	2 cut(s)	87, 172
HhaI	GCGC	2 cut(s)	235, 503
Hin1I	GRCGYC	2 cut(s)	98, 183
Hin1II	CATG	3 cut(s)	226, 431, 599
Hin6I	GCGC	2 cut(s)	233, 501
HinP1I	GCGC	2 cut(s)	233, 501
HpaII	CCGG	3 cut(s)	144, 193, 398
HphI	GGTGA	6 cut(s)	40, 182, 310, 412, 535, 574
Hpy166II	GTNNAC	1 cut(s)	190
Hpy188I	TCNGA	3 cut(s)	125, 560, 579
Hpy188III	TCNNGA	3 cut(s)	468, 553, 751
Hpy8I	GTNNAC	1 cut(s)	190
Hpy99I	CGWCG	4 cut(s)	20, 103, 167, 188
HpyAV	CCTTC	5 cut(s)	55, 61, 712, 745, 784
HpyCH4III	ACNGT	2 cut(s)	640, 726
HpyCH4IV	ACGT	1 cut(s)	707
HpyCH4V	TGCA	2 cut(s)	31, 718
HpyF10VI	GCNNNNNNNGC	2 cut(s)	662, 781
HpyF3I	CTNAG	1 cut(s)	257
HpySE526I	ACGT	1 cut(s)	707
Hsp92I	GRCGYC	2 cut(s)	98, 183
Hsp92II	CATG	3 cut(s)	226, 431, 599
HspAI	GCGC	2 cut(s)	233, 501
Ksp22I	TGATCA	4 cut(s)	315, 540, 555, 579
Kzo9I	GATC	5 cut(s)	110, 315, 540, 555, 579
LmnI	GCTCC	2 cut(s)	224, 470
LpnPI	CCDG	9 cut(s)	157, 206, 225, 330, 378, 411, 612, 665, 770
Lsp1109I	GCAGC	5 cut(s)	217, 291, 353, 635, 702
LweI	GCATC	2 cut(s)	639, 770
MaeII	ACGT	1 cut(s)	707
MalI	GATC	5 cut(s)	112, 317, 542, 557, 581
MboI	GATC	5 cut(s)	110, 315, 540, 555, 579
MboII	GAAGA	3 cut(s)	112, 360, 607
MfeI	CAATTG	2 cut(s)	273, 504
MhlI	GDGCHC	2 cut(s)	221, 338
MluCI	AATT	7 cut(s)	60, 147, 262, 273, 280, 475, 504
MnlI	CCTC	9 cut(s)	92, 124, 127, 170, 266, 331, 456, 556, 738
MseI	TTAA	2 cut(s)	410, 423
MslI	CAYNNNNRTG	1 cut(s)	323
MspA1I	CMGCKG	1 cut(s)	344
MspCI	CTTAAG	1 cut(s)	422
MspI	CCGG	3 cut(s)	144, 193, 398
MunI	CAATTG	2 cut(s)	273, 504
MwoI	GCNNNNNNNGC	2 cut(s)	662, 781
NdeII	GATC	5 cut(s)	110, 315, 540, 555, 579
NlaIII	CATG	3 cut(s)	226, 431, 599
NlaIV	GGNNCC	3 cut(s)	337, 700, 733
NsbI	TGCGCA	1 cut(s)	502
PkrI	GCNGC	5 cut(s)	232, 306, 343, 625, 717
Ple19I	CGATCG	1 cut(s)	113
PpuMI	RGGWCCY	1 cut(s)	699
PsiI	TTATAA	1 cut(s)	689
Psp5II	RGGWCCY	1 cut(s)	699
PspN4I	GGNNCC	3 cut(s)	337, 700, 733
PspPI	GGNCC	2 cut(s)	395, 699
PspPPI	RGGWCCY	1 cut(s)	699
PvuI	CGATCG	1 cut(s)	113
PvuII	CAGCTG	1 cut(s)	344
RseI	CAYNNNNRTG	1 cut(s)	323
SaqAI	TTAA	2 cut(s)	410, 423
SatI	GCNGC	5 cut(s)	231, 305, 342, 624, 716
Sau3AI	GATC	5 cut(s)	110, 315, 540, 555, 579
Sau96I	GGNCC	2 cut(s)	395, 699
SduI	GDGCHC	2 cut(s)	221, 338
SetI	ASST	9 cut(s)	53, 90, 162, 323, 346, 416, 467, 548, 710
SfaNI	GCATC	2 cut(s)	639, 770
SfcI	CTRYAG	1 cut(s)	525
SinI	GGWCC	2 cut(s)	395, 699
SmiMI	CAYNNNNRTG	1 cut(s)	323
SmlI	CTYRAG	3 cut(s)	83, 91, 422
SmoI	CTYRAG	3 cut(s)	83, 91, 422
Sse9I	AATT	7 cut(s)	60, 147, 262, 273, 280, 475, 504
SsiI	CCGC	2 cut(s)	141, 339
TaaI	ACNGT	2 cut(s)	640, 726
TaiI	ACGT	1 cut(s)	710
TaqI	TCGA	5 cut(s)	109, 162, 511, 647, 743
TasI	AATT	7 cut(s)	60, 147, 262, 273, 280, 475, 504
Tru1I	TTAA	2 cut(s)	410, 423
Tru9I	TTAA	2 cut(s)	410, 423
TscAI	CASTG	1 cut(s)	72
TseI	GCWGC	5 cut(s)	230, 304, 341, 623, 715
TspDTI	ATGAA	3 cut(s)	584, 601, 770
TspRI	CASTG	1 cut(s)	72
Vha464I	CTTAAG	1 cut(s)	422
VpaK11BI	GGWCC	2 cut(s)	395, 699
XapI	RAATTY	1 cut(s)	147

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.