Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007889.1

Orthogroup ID

OG0009555

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1603

Gene Structure 1603 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007889.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 522 bp

aattactttggttgcttcttttcgctgccgatagtgatcacctcaatgagatggggcaccgcagctggaagaaaaactatggtggcaacgactatgctattacttgtcttgtctggtccggtgaaagccttaacctatttgcttaagcatggattagttggctttacaatgggaagtttgtggaggtcgggagcaaattggactatttcagttttcttgtgcgcaattgttcgagcattgggttctgtagggtatgttttgatcacctctttcttgatcagagaaaacatatttgctctgatcaccataaacattcatgcttctctaacattcatcttcacagcagcaggcatctatacagttccatcgatggaagcaatatatgccttatttagtattctggtttttataaatagtgggtccttcacgttcttgctgcacatactgtatggtgccttcctttcgaggctcgggatgaaagcatctttgagattgccaagatggctggagaaggcaatatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF2232

Protein Analysis

173

Amino Acids

19.06

Weight (kDa)

10.24

Isoelectric Point (pI)

32.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009555)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G26180 AT1G26180
fragaria_vesca	FvH4_4g28590 FvH4_4g28590
malus_domestica	MD13G1052300.v1.1 MD16G1057600.v1.1
prunus_persica	Prupe.1G299800_v2.0.a1
pyrus_communis	pycom03g00020 pycom13g04660 pycom16g05040
rosa_chinensis	RchiOBHm_Chr4g0436681
rosa_laevigata	RLG00000006504
rosa_multiflora	Rmu_sc0003130.1_g000020 Rmu_sc0007889.1_g000001
rosa_roxburghii	Rroxscaffold_5G00377760
rosa_rugosa	Rorug04G0295200
rosa_samantha	Rh4AG040800 Rh4AG349700 Rh4BG358400 Rh4CG372800 Rh4DG352600
rosa_wichuraiana	Rw4G030590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	410
Acc16I	TGCGCA	1 cut(s)	223
AccB1I	GGYRCC	2 cut(s)	56, 452
AciI	CCGC	1 cut(s)	60
AflII	CTTAAG	1 cut(s)	143
AluBI	AGCT	1 cut(s)	65
AluI	AGCT	1 cut(s)	65
Ama87I	CYCGRG	1 cut(s)	470
ApeKI	GCWGC	4 cut(s)	25, 62, 344, 436
AspLEI	GCGC	1 cut(s)	224
AspS9I	GGNCC	2 cut(s)	116, 420
AsuHPI	GGTGA	4 cut(s)	31, 133, 256, 295
AvaI	CYCGRG	1 cut(s)	470
AvaII	GGWCC	2 cut(s)	116, 420
BaeGI	GKGCMC	1 cut(s)	59
BanI	GGYRCC	2 cut(s)	56, 452
BarI	GAAGNNNNNNTAC	2 cut(s)	440, 472
BbvI	GCAGC	4 cut(s)	12, 74, 356, 423
BccI	CCATC	4 cut(s)	45, 364, 373, 495
BclI	TGATCA	4 cut(s)	36, 261, 276, 300
BfmI	CTRYAG	1 cut(s)	246
BfrI	CTTAAG	1 cut(s)	143
BglI	GCCNNNNNGGC	1 cut(s)	502
BisI	GCNGC	4 cut(s)	26, 63, 345, 437
BlsI	GCNGC	4 cut(s)	27, 64, 346, 438
Bme18I	GGWCC	2 cut(s)	116, 420
BmeT110I	CYCGRG	1 cut(s)	470
BmgT120I	GGNCC	2 cut(s)	116, 420
BmiI	GGNNCC	3 cut(s)	58, 421, 454
BmsI	GCATC	2 cut(s)	360, 491
Bsa29I	ATCGAT	1 cut(s)	368
BsaBI	GATNNNNATC	1 cut(s)	35
BsaWI	WCCGGW	1 cut(s)	118
Bse8I	GATNNNNATC	1 cut(s)	35
BseCI	ATCGAT	1 cut(s)	368
BseGI	GGATG	1 cut(s)	480
BseJI	GATNNNNATC	1 cut(s)	35
BseSI	GKGCMC	1 cut(s)	59
BseXI	GCAGC	4 cut(s)	12, 74, 356, 423
BsgI	GTGCAG	1 cut(s)	422
BshNI	GGYRCC	2 cut(s)	56, 452
BshVI	ATCGAT	1 cut(s)	368
BsiHKCI	CYCGRG	1 cut(s)	470
BsiSI	CCGG	1 cut(s)	119
BsoBI	CYCGRG	1 cut(s)	470
Bsp1286I	GDGCHC	1 cut(s)	59
Bsp143I	GATC	4 cut(s)	36, 261, 276, 300
BspACI	CCGC	1 cut(s)	60
BspDI	ATCGAT	1 cut(s)	368
BspLI	GGNNCC	3 cut(s)	58, 421, 454
BspT107I	GGYRCC	2 cut(s)	56, 452
BspTI	CTTAAG	1 cut(s)	143
BssMI	GATC	4 cut(s)	36, 261, 276, 300
Bst4CI	ACNGT	2 cut(s)	361, 447
BstAFI	CTTAAG	1 cut(s)	143
BstAPI	GCANNNNNTGC	1 cut(s)	383
BstC8I	GCNNGC	1 cut(s)	349
BstF5I	GGATG	1 cut(s)	480
BstHHI	GCGC	1 cut(s)	224
BstKTI	GATC	4 cut(s)	39, 264, 279, 303
BstMBI	GATC	4 cut(s)	36, 261, 276, 300
BstMWI	GCNNNNNNNGC	2 cut(s)	383, 502
BstSFI	CTRYAG	1 cut(s)	246
BstSLI	GKGCMC	1 cut(s)	59
BstV1I	GCAGC	4 cut(s)	12, 74, 356, 423
Bsu15I	ATCGAT	1 cut(s)	368
BsuTUI	ATCGAT	1 cut(s)	368
BtsCI	GGATG	1 cut(s)	480
Cac8I	GCNNGC	1 cut(s)	349
CfoI	GCGC	1 cut(s)	224
Cfr13I	GGNCC	2 cut(s)	116, 420
ClaI	ATCGAT	1 cut(s)	368
CviAII	CATG	2 cut(s)	149, 317
CviJI	RGCY	5 cut(s)	65, 128, 162, 469, 505
CviKI_1	RGCY	5 cut(s)	65, 128, 162, 469, 505
DpnI	GATC	4 cut(s)	38, 263, 278, 302
DpnII	GATC	4 cut(s)	36, 261, 276, 300
Eco47I	GGWCC	2 cut(s)	116, 420
Eco88I	CYCGRG	1 cut(s)	470
EcoO109I	RGGNCCY	1 cut(s)	420
FaeI	CATG	2 cut(s)	152, 320
FatI	CATG	2 cut(s)	148, 316
FbaI	TGATCA	4 cut(s)	36, 261, 276, 300
Fnu4HI	GCNGC	4 cut(s)	26, 63, 345, 437
FokI	GGATG	1 cut(s)	487
Fsp4HI	GCNGC	4 cut(s)	26, 63, 345, 437
FspI	TGCGCA	1 cut(s)	223
GlaI	GCGC	1 cut(s)	223
GluI	GCNGC	4 cut(s)	26, 63, 345, 437
HapII	CCGG	1 cut(s)	119
HhaI	GCGC	1 cut(s)	224
Hin1II	CATG	2 cut(s)	152, 320
Hin6I	GCGC	1 cut(s)	222
HinP1I	GCGC	1 cut(s)	222
HpaII	CCGG	1 cut(s)	119
HphI	GGTGA	4 cut(s)	31, 133, 256, 295
Hpy188I	TCNGA	2 cut(s)	281, 300
Hpy188III	TCNNGA	3 cut(s)	189, 274, 472
HpyAV	CCTTC	3 cut(s)	433, 466, 505
HpyCH4III	ACNGT	2 cut(s)	361, 447
HpyCH4IV	ACGT	1 cut(s)	428
HpyCH4V	TGCA	1 cut(s)	439
HpyF10VI	GCNNNNNNNGC	2 cut(s)	383, 502
HpySE526I	ACGT	1 cut(s)	428
Hsp92II	CATG	2 cut(s)	152, 320
HspAI	GCGC	1 cut(s)	222
Ksp22I	TGATCA	4 cut(s)	36, 261, 276, 300
Kzo9I	GATC	4 cut(s)	36, 261, 276, 300
LmnI	GCTCC	1 cut(s)	191
LpnPI	CCDG	6 cut(s)	51, 99, 132, 333, 386, 491
Lsp1109I	GCAGC	4 cut(s)	12, 74, 356, 423
LweI	GCATC	2 cut(s)	360, 491
MaeII	ACGT	1 cut(s)	428
MalI	GATC	4 cut(s)	38, 263, 278, 302
MboI	GATC	4 cut(s)	36, 261, 276, 300
MboII	GAAGA	2 cut(s)	81, 328
MfeI	CAATTG	1 cut(s)	225
MhlI	GDGCHC	1 cut(s)	59
MluCI	AATT	2 cut(s)	196, 225
MnlI	CCTC	4 cut(s)	52, 177, 277, 459
MseI	TTAA	2 cut(s)	131, 144
MslI	CAYNNNNRTG	1 cut(s)	44
MspA1I	CMGCKG	1 cut(s)	65
MspCI	CTTAAG	1 cut(s)	143
MspI	CCGG	1 cut(s)	119
MunI	CAATTG	1 cut(s)	225
MwoI	GCNNNNNNNGC	2 cut(s)	383, 502
NdeII	GATC	4 cut(s)	36, 261, 276, 300
NlaIII	CATG	2 cut(s)	152, 320
NlaIV	GGNNCC	3 cut(s)	58, 421, 454
NsbI	TGCGCA	1 cut(s)	223
PkrI	GCNGC	4 cut(s)	27, 64, 346, 438
PpuMI	RGGWCCY	1 cut(s)	420
PsiI	TTATAA	1 cut(s)	410
Psp5II	RGGWCCY	1 cut(s)	420
PspN4I	GGNNCC	3 cut(s)	58, 421, 454
PspPI	GGNCC	2 cut(s)	116, 420
PspPPI	RGGWCCY	1 cut(s)	420
PvuII	CAGCTG	1 cut(s)	65
RseI	CAYNNNNRTG	1 cut(s)	44
SaqAI	TTAA	2 cut(s)	131, 144
SatI	GCNGC	4 cut(s)	26, 63, 345, 437
Sau3AI	GATC	4 cut(s)	36, 261, 276, 300
Sau96I	GGNCC	2 cut(s)	116, 420
SduI	GDGCHC	1 cut(s)	59
SetI	ASST	6 cut(s)	44, 67, 137, 188, 269, 431
SfaNI	GCATC	2 cut(s)	360, 491
SfcI	CTRYAG	1 cut(s)	246
SinI	GGWCC	2 cut(s)	116, 420
SmiMI	CAYNNNNRTG	1 cut(s)	44
SmlI	CTYRAG	1 cut(s)	143
SmoI	CTYRAG	1 cut(s)	143
Sse9I	AATT	2 cut(s)	196, 225
SsiI	CCGC	1 cut(s)	60
TaaI	ACNGT	2 cut(s)	361, 447
TaiI	ACGT	1 cut(s)	431
TaqI	TCGA	3 cut(s)	232, 368, 464
TasI	AATT	2 cut(s)	196, 225
Tru1I	TTAA	2 cut(s)	131, 144
Tru9I	TTAA	2 cut(s)	131, 144
TseI	GCWGC	4 cut(s)	25, 62, 344, 436
TspDTI	ATGAA	3 cut(s)	305, 322, 491
Vha464I	CTTAAG	1 cut(s)	143
VpaK11BI	GGWCC	2 cut(s)	116, 420

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.