Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003314.1

Orthogroup ID

OG0012698

Physical Location & Seq

Genomic Coordinates Reverse (-)

15461 .. 18714

Gene Structure 3254 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003314.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1071 bp

atggaggataatgaacatgatagagatggttcgggaagacaagaaatggaggctgagcgtcacatgacattctcaacaaaaaggaccacagaaccatatattattgacaaggcttggtgtcttcttgaacttttgtcaacaactcatgttccagtgcctgtggcaatagatataatagatggcagcgtgaaacatgattacatcaagattggttttcaagaaggtgggctttgttcaatacatgggatcaaggaggaggagtactgtaaacgatggaattgtcttcgctggtcactacatgcactttcagaactgaagggttgtgatctgtttcttaatgcacacactgttactgctgtggggacttcacgtgaagtaagtcgtttgatcaggttgattgtggaagactgcatcatttccaatgtgtgtcctgcaactgctgccaggaatgtgagtgataacttattcgaaacataccgaccacctgaaaccacagaggacccacacgtcgcccacatgaagatgaagtatgacggcatggctgagatcacctgtttctgtaggttatacgctaatgcgaccgtgttggaaaaagattggcagatgttgcagtcgtgtttgaaggattacagcaatatttcatgcacactggttgcgaacgactgtggcatgacggtctcaatagtcagaagcattggggattcagatattgttgggaaggcttgggatcttcttcgactcatgtcagcaactaaagttccggttcttttggcagagatgatactgaaaggcactctgcactgtgtcttcatcaagactgggtatgacggtggcctttgctcaaaaattgggatcaagatgcgtcaattttatcaagtactgctgccacgtcttgagtgcatcttgaagaatgctgcaagccgagcaggttgcaagcttttgttcaaggatgaaactataattgtgttggggaaagatcctgcagtcttaaatttgttcgagatgagtgcacggaaatggctggaagaacacaaggatgataaggatgattatgaaagtcgcaaagattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00590 ko00790 ko00980 ko01100 ko05204 map00590 map00790 map00980 map01100 map05204

Pfam Domains

Protein Families

adh_short

Protein Analysis

356

Amino Acids

40.28

Weight (kDa)

5.82

Isoelectric Point (pI)

47.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012698)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr7g0195631 RchiOBHm_Chr7g0195641 RchiOBHm_Chr7g0211811
rosa_multiflora	Rmu_sc0003314.1_g000004 Rmu_sc0010418.1_g000006
rosa_roxburghii	Rroxscaffold_3G00260270 Rroxscaffold_4G00308620
rosa_rugosa	Rorug07G0025200 Rorug07G0025300
rosa_samantha	Rh4AG083700 Rh4CG090800 Rh7AG152800 Rh7BG154300 Rh7CG158000 Rh7CG158100 Rh7CG158200 Rh7DG153800
rosa_wichuraiana	Rw7G013060 Rw7G013070

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	506
Acc36I	ACCTGC	1 cut(s)	917
AclWI	GGATC	4 cut(s)	254, 735, 860, 971
AcsI	RAATTY	1 cut(s)	991
AcuI	CTGAAG	1 cut(s)	335
AcvI	CACGTG	1 cut(s)	371
AfaI	GTAC	2 cut(s)	263, 879
AflIII	ACRYGT	1 cut(s)	505
AgsI	TTSAA	6 cut(s)	128, 218, 237, 622, 907, 946
AjiI	CACGTC	2 cut(s)	508, 890
AjnI	CCWGG	1 cut(s)	443
AluBI	AGCT	1 cut(s)	937
AluI	AGCT	1 cut(s)	937
Alw21I	GWGCWC	1 cut(s)	1012
Alw26I	GTCTC	1 cut(s)	682
Alw44I	GTGCAC	1 cut(s)	1008
AlwI	GGATC	4 cut(s)	254, 735, 860, 971
AlwNI	CAGNNNCTG	1 cut(s)	158
AoxI	GGCC	1 cut(s)	832
ApaLI	GTGCAC	1 cut(s)	1008
ApeKI	GCWGC	4 cut(s)	183, 440, 883, 914
ApoI	RAATTY	1 cut(s)	991
AspS9I	GGNCC	2 cut(s)	84, 499
AsuHPI	GGTGA	1 cut(s)	541
AsuII	TTCGAA	1 cut(s)	468
AvaII	GGWCC	2 cut(s)	84, 499
BaeGI	GKGCMC	1 cut(s)	1012
BbrPI	CACGTG	1 cut(s)	371
BbsI	GAAGAC	5 cut(s)	43, 113, 275, 411, 799
Bbv12I	GWGCWC	1 cut(s)	1012
BbvI	GCAGC	4 cut(s)	195, 427, 870, 901
BccI	CCATC	3 cut(s)	20, 173, 267
BceAI	ACGGC	1 cut(s)	550
BcgI	CGANNNNNNTGC	4 cut(s)	912, 946, 989, 1023
BciT130I	CCWGG	1 cut(s)	445
BclI	TGATCA	1 cut(s)	387
BcoDI	GTCTC	1 cut(s)	682
BfmI	CTRYAG	2 cut(s)	559, 981
BfuAI	ACCTGC	1 cut(s)	917
BisI	GCNGC	4 cut(s)	184, 441, 884, 915
BlpI	GCTNAGC	1 cut(s)	54
BlsI	GCNGC	4 cut(s)	185, 442, 885, 916
BmcAI	AGTACT	2 cut(s)	263, 879
Bme1390I	CCNGG	1 cut(s)	445
Bme18I	GGWCC	2 cut(s)	84, 499
BmgBI	CACGTC	2 cut(s)	508, 890
BmgT120I	GGNCC	2 cut(s)	84, 499
BmiI	GGNNCC	1 cut(s)	501
BmrFI	CCNGG	1 cut(s)	445
BmrI	ACTGGG	1 cut(s)	828
BmsI	GCATC	3 cut(s)	420, 849, 909
BmuI	ACTGGG	1 cut(s)	828
BoxI	GACNNNNGTC	1 cut(s)	742
BpiI	GAAGAC	5 cut(s)	43, 113, 275, 411, 799
Bpu1102I	GCTNAGC	1 cut(s)	54
Bpu14I	TTCGAA	1 cut(s)	468
BpuEI	CTTGAG	1 cut(s)	914
BsaAI	YACGTR	1 cut(s)	371
BsaI	GGTCTC	1 cut(s)	682
BsaWI	WCCGGW	1 cut(s)	760
BsaXI	ACNNNNNCTCC	2 cut(s)	245, 275
Bse1I	ACTGG	3 cut(s)	152, 654, 823
BseBI	CCWGG	1 cut(s)	445
BseGI	GGATG	3 cut(s)	955, 1042, 1051
BseMII	CTCAG	2 cut(s)	45, 534
BseNI	ACTGG	3 cut(s)	152, 654, 823
BseRI	GAGGAG	2 cut(s)	269, 272
BseSI	GKGCMC	1 cut(s)	1012
BseXI	GCAGC	4 cut(s)	195, 427, 870, 901
BsgI	GTGCAG	1 cut(s)	782
Bsh1285I	CGRYCG	1 cut(s)	582
BshFI	GGCC	1 cut(s)	834
BsiEI	CGRYCG	1 cut(s)	582
BsiHKAI	GWGCWC	1 cut(s)	1012
BsiSI	CCGG	1 cut(s)	761
BslFI	GGGAC	1 cut(s)	376
BsmAI	GTCTC	1 cut(s)	682
BsmFI	GGGAC	1 cut(s)	376
BsmI	GAATGC	1 cut(s)	916
BsnI	GGCC	1 cut(s)	834
Bso31I	GGTCTC	1 cut(s)	682
Bsp119I	TTCGAA	1 cut(s)	468
Bsp1286I	GDGCHC	1 cut(s)	1012
Bsp143I	GATC	7 cut(s)	246, 325, 387, 546, 727, 852, 976
Bsp1720I	GCTNAGC	1 cut(s)	54
BspANI	GGCC	1 cut(s)	834
BspCNI	CTCAG	2 cut(s)	46, 535
BspLI	GGNNCC	1 cut(s)	501
BspMAI	CTGCAG	1 cut(s)	985
BspMI	ACCTGC	1 cut(s)	917
BspPI	GGATC	4 cut(s)	254, 735, 860, 971
BspT104I	TTCGAA	1 cut(s)	468
BspTNI	GGTCTC	1 cut(s)	682
BsrI	ACTGG	3 cut(s)	152, 654, 823
BssMI	GATC	7 cut(s)	246, 325, 387, 546, 727, 852, 976
Bst2UI	CCWGG	1 cut(s)	445
Bst4CI	ACNGT	7 cut(s)	266, 349, 583, 665, 676, 803, 830
BstAPI	GCANNNNNTGC	2 cut(s)	440, 607
BstBAI	YACGTR	1 cut(s)	371
BstBI	TTCGAA	1 cut(s)	468
BstC8I	GCNNGC	2 cut(s)	919, 935
BstDEI	CTNAG	2 cut(s)	54, 543
BstF5I	GGATG	3 cut(s)	955, 1042, 1051
BstKTI	GATC	7 cut(s)	249, 328, 390, 549, 730, 855, 979
BstMAI	GTCTC	1 cut(s)	682
BstMBI	GATC	7 cut(s)	246, 325, 387, 546, 727, 852, 976
BstMCI	CGRYCG	1 cut(s)	582
BstMWI	GCNNNNNNNGC	3 cut(s)	440, 607, 923
BstNI	CCWGG	1 cut(s)	445
BstNSI	RCATGY	1 cut(s)	302
BstPAI	GACNNNNGTC	1 cut(s)	742
BstSCI	CCNGG	1 cut(s)	443
BstSFI	CTRYAG	2 cut(s)	559, 981
BstSLI	GKGCMC	1 cut(s)	1012
BstV1I	GCAGC	4 cut(s)	195, 427, 870, 901
BstV2I	GAAGAC	5 cut(s)	43, 113, 275, 411, 799
BstX2I	RGATCY	2 cut(s)	727, 976
BstYI	RGATCY	2 cut(s)	727, 976
BsuRI	GGCC	1 cut(s)	834
BtrI	CACGTC	2 cut(s)	508, 890
BtsCI	GGATG	3 cut(s)	955, 1042, 1051
BtsIMutI	CAGTG	4 cut(s)	159, 345, 647, 799
BveI	ACCTGC	1 cut(s)	917
Cac8I	GCNNGC	2 cut(s)	919, 935
CaiI	CAGNNNCTG	1 cut(s)	158
Cfr13I	GGNCC	2 cut(s)	84, 499
CseI	GACGC	2 cut(s)	47, 851
Csp6I	GTAC	2 cut(s)	262, 878
CviJI	RGCY	9 cut(s)	53, 113, 229, 542, 722, 834, 921, 937, 1021
CviKI_1	RGCY	9 cut(s)	53, 113, 229, 542, 722, 834, 921, 937, 1021
CviQI	GTAC	2 cut(s)	262, 878
DdeI	CTNAG	2 cut(s)	54, 543
DpnI	GATC	7 cut(s)	248, 327, 389, 548, 729, 854, 978
DpnII	GATC	7 cut(s)	246, 325, 387, 546, 727, 852, 976
DrdI	GACNNNNNNGTC	1 cut(s)	506
DseDI	GACNNNNNNGTC	1 cut(s)	506
Eco31I	GGTCTC	1 cut(s)	682
Eco47I	GGWCC	2 cut(s)	84, 499
Eco57I	CTGAAG	1 cut(s)	335
Eco72I	CACGTG	1 cut(s)	371
EcoO109I	RGGNCCY	1 cut(s)	499
EcoRII	CCWGG	1 cut(s)	443
FalI	AAGNNNNNCTT	2 cut(s)	213, 245
FaqI	GGGAC	1 cut(s)	376
FbaI	TGATCA	1 cut(s)	387
Fnu4HI	GCNGC	4 cut(s)	184, 441, 884, 915
FokI	GGATG	3 cut(s)	962, 1049, 1058
Fsp4HI	GCNGC	4 cut(s)	184, 441, 884, 915
GluI	GCNGC	4 cut(s)	184, 441, 884, 915
HaeIII	GGCC	1 cut(s)	834
HapII	CCGG	1 cut(s)	761
HgaI	GACGC	2 cut(s)	47, 851
HincII	GTYRAC	1 cut(s)	138
HindII	GTYRAC	1 cut(s)	138
HindIII	AAGCTT	1 cut(s)	935
HinfI	GANTC	2 cut(s)	701, 738
HpaII	CCGG	1 cut(s)	761
HphI	GGTGA	1 cut(s)	541
Hpy166II	GTNNAC	3 cut(s)	138, 269, 1010
Hpy188I	TCNGA	3 cut(s)	310, 689, 706
Hpy188III	TCNNGA	9 cut(s)	33, 125, 205, 218, 814, 856, 893, 904, 1000
Hpy8I	GTNNAC	3 cut(s)	138, 269, 1010
Hpy99I	CGWCG	1 cut(s)	512
HpyAV	CCTTC	4 cut(s)	215, 310, 616, 712
HpyCH4III	ACNGT	7 cut(s)	266, 349, 583, 665, 676, 803, 830
HpyCH4IV	ACGT	3 cut(s)	370, 507, 889
HpyF10VI	GCNNNNNNNGC	3 cut(s)	440, 607, 923
HpyF3I	CTNAG	2 cut(s)	54, 543
HpySE526I	ACGT	3 cut(s)	370, 507, 889
Ksp22I	TGATCA	1 cut(s)	387
Kzo9I	GATC	7 cut(s)	246, 325, 387, 546, 727, 852, 976
Lsp1109I	GCAGC	4 cut(s)	195, 427, 870, 901
LweI	GCATC	3 cut(s)	420, 849, 909
MaeII	ACGT	3 cut(s)	370, 507, 889
MaeIII	GTNAC	3 cut(s)	59, 291, 349
MalI	GATC	7 cut(s)	248, 327, 389, 548, 729, 854, 978
MboI	GATC	7 cut(s)	246, 325, 387, 546, 727, 852, 976
MflI	RGATCY	2 cut(s)	727, 976
MhlI	GDGCHC	1 cut(s)	1012
MluCI	AATT	5 cut(s)	277, 846, 866, 960, 991
MlyI	GAGTC	1 cut(s)	732
MmeI	TCCRAC	1 cut(s)	567
MnlI	CCTC	4 cut(s)	43, 247, 250, 490
MseI	TTAA	2 cut(s)	336, 989
MslI	CAYNNNNRTG	3 cut(s)	521, 1015, 1035
MspI	CCGG	1 cut(s)	761
MspR9I	CCNGG	1 cut(s)	445
Mva1269I	GAATGC	1 cut(s)	916
MvaI	CCWGG	1 cut(s)	445
MwoI	GCNNNNNNNGC	3 cut(s)	440, 607, 923
NdeII	GATC	7 cut(s)	246, 325, 387, 546, 727, 852, 976
NlaIV	GGNNCC	1 cut(s)	501
NmeAIII	GCCGAG	1 cut(s)	947
NmuCI	GTSAC	2 cut(s)	59, 291
NspI	RCATGY	1 cut(s)	302
NspV	TTCGAA	1 cut(s)	468
PctI	GAATGC	1 cut(s)	916
PfeI	GAWTC	1 cut(s)	701
PkrI	GCNGC	4 cut(s)	185, 442, 885, 916
PleI	GAGTC	1 cut(s)	732
PmaCI	CACGTG	1 cut(s)	371
PmlI	CACGTG	1 cut(s)	371
PpsI	GAGTC	1 cut(s)	732
Ppu21I	YACGTR	1 cut(s)	371
PpuMI	RGGWCCY	1 cut(s)	499
PshAI	GACNNNNGTC	1 cut(s)	742
Psp5II	RGGWCCY	1 cut(s)	499
Psp6I	CCWGG	1 cut(s)	443
PspCI	CACGTG	1 cut(s)	371
PspGI	CCWGG	1 cut(s)	443
PspN4I	GGNNCC	1 cut(s)	501
PspPI	GGNCC	2 cut(s)	84, 499
PspPPI	RGGWCCY	1 cut(s)	499
PstI	CTGCAG	1 cut(s)	985
PstNI	CAGNNNCTG	1 cut(s)	158
PsuI	RGATCY	2 cut(s)	727, 976
RsaI	GTAC	2 cut(s)	263, 879
RsaNI	GTAC	2 cut(s)	262, 878
RseI	CAYNNNNRTG	3 cut(s)	521, 1015, 1035
SaqAI	TTAA	2 cut(s)	336, 989
SatI	GCNGC	4 cut(s)	184, 441, 884, 915
Sau3AI	GATC	7 cut(s)	246, 325, 387, 546, 727, 852, 976
Sau96I	GGNCC	2 cut(s)	84, 499
ScaI	AGTACT	2 cut(s)	263, 879
SchI	GAGTC	1 cut(s)	732
ScrFI	CCNGG	1 cut(s)	445
SduI	GDGCHC	1 cut(s)	1012
SfaNI	GCATC	3 cut(s)	420, 849, 909
SfcI	CTRYAG	2 cut(s)	559, 981
SfuI	TTCGAA	1 cut(s)	468
SinI	GGWCC	2 cut(s)	84, 499
SmiMI	CAYNNNNRTG	3 cut(s)	521, 1015, 1035
SmlI	CTYRAG	1 cut(s)	893
SmoI	CTYRAG	1 cut(s)	893
Sse9I	AATT	5 cut(s)	277, 846, 866, 960, 991
SspI	AATATT	1 cut(s)	637
StyD4I	CCNGG	1 cut(s)	443
TaaI	ACNGT	7 cut(s)	266, 349, 583, 665, 676, 803, 830
TaiI	ACGT	3 cut(s)	373, 510, 892
TaqI	TCGA	3 cut(s)	468, 736, 999
TasI	AATT	5 cut(s)	277, 846, 866, 960, 991
TatI	WGTACW	2 cut(s)	261, 877
TfiI	GAWTC	1 cut(s)	701
Tru1I	TTAA	2 cut(s)	336, 989
Tru9I	TTAA	2 cut(s)	336, 989
TscAI	CASTG	4 cut(s)	159, 352, 654, 806
TseFI	GTSAC	2 cut(s)	59, 291
TseI	GCWGC	4 cut(s)	183, 440, 883, 914
Tsp45I	GTSAC	2 cut(s)	59, 291
TspDTI	ATGAA	7 cut(s)	27, 533, 539, 630, 799, 966, 1068
TspGWI	ACGGA	1 cut(s)	1027
TspRI	CASTG	4 cut(s)	159, 352, 654, 806
VneI	GTGCAC	1 cut(s)	1008
VpaK11BI	GGWCC	2 cut(s)	84, 499
XapI	RAATTY	1 cut(s)	991
XceI	RCATGY	1 cut(s)	302
ZrmI	AGTACT	2 cut(s)	263, 879

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.