Rmu_sc0003347.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003347.1
OG0007512
Physical Location & Seq
Reverse (-)
2488 .. 3524
1037 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003347.1_g000001.1.cds

Sequence Viewer

Length: 504 bp
atgacacaatgggtttatgttatggattttagtaagttggtcaatgagttaaaggagctggttgggcctcaagtagttaccattcgtggggaaattgctgcagctcagagagaacaggctgaggttgaagaggctattaatagaataaaaacaagggttgaatggatggggaatgcgatgaagcagtttaaggatgaagtagctgcatctgagattgagcatttgctggtttttggaatgtacgtgagcaatgattttgaggctgaggtcaaagaggctgttagtggactaaaatcaacaactgaacaacttaggggggatggttttggcaaggatctgataacgaagttttccgcgttacaagctgcagatcagaaaaatcaggatgagcttaaagaggttgttaaaaaagtaggaatctggaaggaatgggtggagaatactttgaagcagattgaggaacttgaaacaagggctgaatgggtgcagaatgcgtgcatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

167

Amino Acids

19.07

Weight (kDa)

4.81

Isoelectric Point (pI)

21.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 356
AciI CCGC 1 cut(s) 354
AclWI GGATC 1 cut(s) 342
AfaI GTAC 1 cut(s) 242
AfiI CCNNNNNNNGG 1 cut(s) 87
AgsI TTSAA 4 cut(s) 128, 161, 448, 467
AluBI AGCT 5 cut(s) 58, 104, 203, 365, 391
AluI AGCT 5 cut(s) 58, 104, 203, 365, 391
AlwI GGATC 1 cut(s) 342
AoxI GGCC 1 cut(s) 65
ApeKI GCWGC 4 cut(s) 98, 101, 203, 365
AseI ATTAAT 1 cut(s) 138
AspS9I GGNCC 1 cut(s) 65
BbvCI CCTCAGC 2 cut(s) 120, 264
BbvI GCAGC 4 cut(s) 85, 113, 190, 352
BccI CCATC 2 cut(s) 160, 314
BfmI CTRYAG 2 cut(s) 99, 366
BisI GCNGC 4 cut(s) 99, 102, 204, 366
BlsI GCNGC 4 cut(s) 100, 103, 205, 367
BmgT120I GGNCC 1 cut(s) 65
BmsI GCATC 1 cut(s) 215
Bpu10I CCTNAGC 2 cut(s) 120, 264
BpuEI CTTGAG 1 cut(s) 54
BsaAI YACGTR 1 cut(s) 244
Bsc4I CCNNNNNNNGG 1 cut(s) 87
Bse3DI GCAATG 1 cut(s) 256
BseGI GGATG 4 cut(s) 171, 199, 325, 391
BseLI CCNNNNNNNGG 1 cut(s) 87
BseMI GCAATG 1 cut(s) 256
BseMII CTCAG 4 cut(s) 111, 119, 201, 255
BseXI GCAGC 4 cut(s) 85, 113, 190, 352
Bsh1236I CGCG 1 cut(s) 356
BshFI GGCC 1 cut(s) 67
BslI CCNNNNNNNGG 1 cut(s) 87
BsmI GAATGC 2 cut(s) 178, 496
BsnI GGCC 1 cut(s) 67
Bsp143I GATC 2 cut(s) 334, 370
BspACI CCGC 1 cut(s) 354
BspANI GGCC 1 cut(s) 67
BspCNI CTCAG 4 cut(s) 112, 118, 202, 256
BspFNI CGCG 1 cut(s) 356
BspMAI CTGCAG 2 cut(s) 103, 370
BspPI GGATC 1 cut(s) 342
BsrDI GCAATG 1 cut(s) 256
BssMI GATC 2 cut(s) 334, 370
Bst6I CTCTTC 1 cut(s) 123
BstBAI YACGTR 1 cut(s) 244
BstC8I GCNNGC 1 cut(s) 496
BstDEI CTNAG 5 cut(s) 105, 120, 210, 264, 311
BstF5I GGATG 4 cut(s) 171, 199, 325, 391
BstFNI CGCG 1 cut(s) 356
BstKTI GATC 2 cut(s) 337, 373
BstMBI GATC 2 cut(s) 334, 370
BstMWI GCNNNNNNNGC 2 cut(s) 64, 362
BstSFI CTRYAG 2 cut(s) 99, 366
BstUI CGCG 1 cut(s) 356
BstV1I GCAGC 4 cut(s) 85, 113, 190, 352
BstX2I RGATCY 1 cut(s) 334
BstYI RGATCY 1 cut(s) 334
BsuRI GGCC 1 cut(s) 67
BtgZI GCGATG 1 cut(s) 191
BtsCI GGATG 4 cut(s) 171, 199, 325, 391
Cac8I GCNNGC 1 cut(s) 496
Cfr13I GGNCC 1 cut(s) 65
Csp6I GTAC 1 cut(s) 241
CviQI GTAC 1 cut(s) 241
DdeI CTNAG 5 cut(s) 105, 120, 210, 264, 311
DpnI GATC 2 cut(s) 336, 372
DpnII GATC 2 cut(s) 334, 370
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
FaiI YATR 2 cut(s) 18, 23
Fnu4HI GCNGC 4 cut(s) 99, 102, 204, 366
FokI GGATG 4 cut(s) 178, 206, 332, 398
Fsp4HI GCNGC 4 cut(s) 99, 102, 204, 366
GluI GCNGC 4 cut(s) 99, 102, 204, 366
HaeIII GGCC 1 cut(s) 67
HinfI GANTC 1 cut(s) 417
Hpy166II GTNNAC 1 cut(s) 287
Hpy188I TCNGA 5 cut(s) 108, 211, 339, 375, 503
Hpy188III TCNNGA 2 cut(s) 383, 421
Hpy8I GTNNAC 1 cut(s) 287
HpyAV CCTTC 1 cut(s) 418
HpyCH4IV ACGT 1 cut(s) 243
HpyCH4V TGCA 5 cut(s) 101, 206, 368, 487, 498
HpyF10VI GCNNNNNNNGC 2 cut(s) 64, 362
HpyF3I CTNAG 5 cut(s) 105, 120, 210, 264, 311
HpySE526I ACGT 1 cut(s) 243
Kzo9I GATC 2 cut(s) 334, 370
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 5 cut(s) 44, 101, 212, 368, 406
Lsp1109I GCAGC 4 cut(s) 85, 113, 190, 352
LweI GCATC 1 cut(s) 215
MaeII ACGT 1 cut(s) 243
MaeIII GTNAC 2 cut(s) 76, 357
MalI GATC 2 cut(s) 336, 372
MboI GATC 2 cut(s) 334, 370
MboII GAAGA 1 cut(s) 140
MflI RGATCY 1 cut(s) 334
MluCI AATT 1 cut(s) 93
MnlI CCTC 8 cut(s) 78, 115, 124, 253, 259, 268, 391, 451
MseI TTAA 5 cut(s) 50, 138, 189, 393, 405
Mva1269I GAATGC 2 cut(s) 178, 496
MvnI CGCG 1 cut(s) 356
MwoI GCNNNNNNNGC 2 cut(s) 64, 362
NdeII GATC 2 cut(s) 334, 370
PctI GAATGC 2 cut(s) 178, 496
PfeI GAWTC 1 cut(s) 417
PkrI GCNGC 4 cut(s) 100, 103, 205, 367
Ppu21I YACGTR 1 cut(s) 244
PshBI ATTAAT 1 cut(s) 138
PspPI GGNCC 1 cut(s) 65
PstI CTGCAG 2 cut(s) 103, 370
PsuI RGATCY 1 cut(s) 334
RsaI GTAC 1 cut(s) 242
RsaNI GTAC 1 cut(s) 241
SaqAI TTAA 5 cut(s) 50, 138, 189, 393, 405
SatI GCNGC 4 cut(s) 99, 102, 204, 366
Sau3AI GATC 2 cut(s) 334, 370
Sau96I GGNCC 1 cut(s) 65
SetI ASST 9 cut(s) 60, 106, 126, 205, 246, 270, 367, 393, 402
SfaNI GCATC 1 cut(s) 215
SfcI CTRYAG 2 cut(s) 99, 366
SmlI CTYRAG 1 cut(s) 69
SmoI CTYRAG 1 cut(s) 69
Sse9I AATT 1 cut(s) 93
SsiI CCGC 1 cut(s) 354
TaiI ACGT 1 cut(s) 246
TasI AATT 1 cut(s) 93
TfiI GAWTC 1 cut(s) 417
Tru1I TTAA 5 cut(s) 50, 138, 189, 393, 405
Tru9I TTAA 5 cut(s) 50, 138, 189, 393, 405
TseI GCWGC 4 cut(s) 98, 101, 203, 365
TspDTI ATGAA 2 cut(s) 194, 210
VspI ATTAAT 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.