Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003458.1

Orthogroup ID

OG0008065

Physical Location & Seq

Genomic Coordinates Reverse (-)

34517 .. 35089

Gene Structure 573 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003458.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 573 bp

atggagaatgggaacctggagaacattatacatgaagatgggatgaatcggtggagattgagattctctcagagaatcaatattttaatctctatagaaagtggactggattacctgcattcaagctatgattttcccatcattcattgcgacttgaagccttctaacatcttgttggatgatgattgggaggccctggagaacattatacatgaagatgggatgaatcggtggagattgagattctctcagagaatcaatattttaatctctatagcaagtggactggattacctgcattcaagctatgattttcccatcattcattgcgacttgaagccttctaacatcttgttggatgatgattgggaggctcatgtgagtgattttggaacagctagaatgttgggtgttcacttccaggatgggagtagcctttccacggcatcagctttccaaggcacaattggctacttggcaccaggtgacaatttgctggctgttcacaattataaactaatctccattcagcttttctctctttttcctttttcagtttcacccttcttctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006810 GO:0006897 GO:0006898 GO:0006950 GO:0006952 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0008150 GO:0008152 GO:0009595 GO:0009605 GO:0009607 GO:0009617 GO:0009987 GO:0010359 GO:0012505 GO:0016020 GO:0016043 GO:0016045 GO:0016192 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0022898 GO:0023052 GO:0031410 GO:0031982 GO:0032409 GO:0032412 GO:0032879 GO:0033036 GO:0033037 GO:0033554 GO:0034762 GO:0034765 GO:0036211 GO:0038023 GO:0042545 GO:0042742 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043269 GO:0043412 GO:0044070 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0045229 GO:0050789 GO:0050794 GO:0050896 GO:0051049 GO:0051179 GO:0051234 GO:0051606 GO:0051641 GO:0051704 GO:0051707 GO:0051716 GO:0052386 GO:0052482 GO:0052542 GO:0052543 GO:0052544 GO:0052545 GO:0060089 GO:0065007 GO:0065009 GO:0070727 GO:0071554 GO:0071555 GO:0071704 GO:0071840 GO:0071944 GO:0097708 GO:0098542 GO:0098543 GO:0098581 GO:0098657 GO:0140096 GO:1901564 GO:1903959

KEGG Pathways

Metabolic & Signaling

ko04016 ko04626 map04016 map04626

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

190

Amino Acids

21.76

Weight (kDa)

4.85

Isoelectric Point (pI)

59.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008065)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G46330 AT5G46330
fragaria_vesca	FvH4_3g06100
malus_domestica	MD05G1289000.v1.1
prunus_persica	Prupe.4G076500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0013311
rosa_laevigata	RLG00000032007 RLG00000032011
rosa_multiflora	Rmu_co8051088.1_g000001 Rmu_sc0003458.1_g000007 Rmu_sc0003458.1_g000011 Rmu_sc0004521.1_g000021 Rmu_sc0007948.1_g000008
rosa_roxburghii	Rroxscaffold_1G00063230
rosa_rugosa	Rorug05G0008800
rosa_samantha	Rh5AG103400 Rh5AG103500 Rh5AG104200 Rh5BG100200 Rh5CG111400 Rh5CG111800 Rh5DG099000
rosa_wichuraiana	Rw5G009030 Rw5G009070

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	513
Acc36I	ACCTGC	2 cut(s)	123, 303
AccB1I	GGYRCC	1 cut(s)	478
AdeI	CACNNNGTG	1 cut(s)	485
AfiI	CCNNNNNNNGG	1 cut(s)	442
AgsI	TTSAA	4 cut(s)	123, 157, 303, 337
AjnI	CCWGG	4 cut(s)	15, 195, 420, 481
AluBI	AGCT	5 cut(s)	126, 306, 398, 452, 532
AluI	AGCT	5 cut(s)	126, 306, 398, 452, 532
AoxI	GGCC	1 cut(s)	192
AspS9I	GGNCC	1 cut(s)	193
AsuHPI	GGTGA	2 cut(s)	497, 552
BanI	GGYRCC	1 cut(s)	478
BccI	CCATC	5 cut(s)	32, 146, 212, 326, 419
BceAI	ACGGC	1 cut(s)	459
BciT130I	CCWGG	4 cut(s)	17, 197, 422, 483
BfaI	CTAG	1 cut(s)	399
BfmI	CTRYAG	2 cut(s)	93, 273
BfuAI	ACCTGC	2 cut(s)	123, 303
Bme1390I	CCNGG	4 cut(s)	17, 197, 422, 483
BmgT120I	GGNCC	1 cut(s)	193
BmiI	GGNNCC	2 cut(s)	14, 480
BmrFI	CCNGG	4 cut(s)	17, 197, 422, 483
BmsI	GCATC	1 cut(s)	455
BplI	GAGNNNNNCTC	4 cut(s)	52, 84, 232, 264
BpmI	CTGGAG	2 cut(s)	38, 218
BsaJI	CCNNGG	3 cut(s)	195, 441, 457
Bsc4I	CCNNNNNNNGG	1 cut(s)	442
Bse1I	ACTGG	2 cut(s)	111, 291
Bse3DI	GCAATG	2 cut(s)	145, 325
BseBI	CCWGG	4 cut(s)	17, 197, 422, 483
BseDI	CCNNGG	3 cut(s)	195, 441, 457
BseGI	GGATG	5 cut(s)	48, 184, 228, 364, 430
BseLI	CCNNNNNNNGG	1 cut(s)	442
BseMI	GCAATG	2 cut(s)	145, 325
BseMII	CTCAG	2 cut(s)	83, 263
BseNI	ACTGG	2 cut(s)	111, 291
BshFI	GGCC	1 cut(s)	194
BshNI	GGYRCC	1 cut(s)	478
BslI	CCNNNNNNNGG	1 cut(s)	442
BsmI	GAATGC	2 cut(s)	118, 298
BsnI	GGCC	1 cut(s)	194
BspANI	GGCC	1 cut(s)	194
BspCNI	CTCAG	2 cut(s)	82, 262
BspLI	GGNNCC	2 cut(s)	14, 480
BspMI	ACCTGC	2 cut(s)	123, 303
BspT107I	GGYRCC	1 cut(s)	478
BsrDI	GCAATG	2 cut(s)	145, 325
BsrI	ACTGG	2 cut(s)	111, 291
BssECI	CCNNGG	3 cut(s)	195, 441, 457
BssT1I	CCWWGG	1 cut(s)	457
Bst2UI	CCWGG	4 cut(s)	17, 197, 422, 483
BstC8I	GCNNGC	1 cut(s)	498
BstDEI	CTNAG	2 cut(s)	69, 249
BstDSI	CCRYGG	1 cut(s)	441
BstF5I	GGATG	5 cut(s)	48, 184, 228, 364, 430
BstMWI	GCNNNNNNNGC	1 cut(s)	468
BstNI	CCWGG	4 cut(s)	17, 197, 422, 483
BstSCI	CCNGG	4 cut(s)	15, 195, 420, 481
BstSFI	CTRYAG	2 cut(s)	93, 273
BsuRI	GGCC	1 cut(s)	194
BtgI	CCRYGG	1 cut(s)	441
BtsCI	GGATG	5 cut(s)	48, 184, 228, 364, 430
BveI	ACCTGC	2 cut(s)	123, 303
Cac8I	GCNNGC	1 cut(s)	498
Cfr13I	GGNCC	1 cut(s)	193
CsiI	ACCWGGT	1 cut(s)	481
CviAII	CATG	3 cut(s)	32, 212, 377
DdeI	CTNAG	2 cut(s)	69, 249
DraIII	CACNNNGTG	1 cut(s)	485
Eco130I	CCWWGG	1 cut(s)	457
EcoO109I	RGGNCCY	1 cut(s)	193
EcoRII	CCWGG	4 cut(s)	15, 195, 420, 481
EcoT14I	CCWWGG	1 cut(s)	457
ErhI	CCWWGG	1 cut(s)	457
FaeI	CATG	3 cut(s)	35, 215, 380
FatI	CATG	3 cut(s)	31, 211, 376
FokI	GGATG	5 cut(s)	55, 191, 235, 371, 437
FspBI	CTAG	1 cut(s)	399
GsuI	CTGGAG	2 cut(s)	38, 218
HaeIII	GGCC	1 cut(s)	194
Hin1II	CATG	3 cut(s)	35, 215, 380
HinfI	GANTC	6 cut(s)	46, 63, 75, 226, 243, 255
HphI	GGTGA	2 cut(s)	497, 552
Hpy166II	GTNNAC	4 cut(s)	104, 284, 415, 505
Hpy188I	TCNGA	3 cut(s)	72, 252, 572
Hpy8I	GTNNAC	4 cut(s)	104, 284, 415, 505
HpyAV	CCTTC	2 cut(s)	171, 351
HpyCH4V	TGCA	2 cut(s)	118, 298
HpyF10VI	GCNNNNNNNGC	1 cut(s)	468
HpyF3I	CTNAG	2 cut(s)	69, 249
Hsp92II	CATG	3 cut(s)	35, 215, 380
LweI	GCATC	1 cut(s)	455
MabI	ACCWGGT	1 cut(s)	481
MaeI	CTAG	1 cut(s)	399
MaeIII	GTNAC	1 cut(s)	485
MboII	GAAGA	3 cut(s)	47, 227, 559
MfeI	CAATTG	1 cut(s)	465
MluCI	AATT	3 cut(s)	465, 490, 508
MmeI	TCCRAC	2 cut(s)	156, 336
MnlI	CCTC	2 cut(s)	184, 364
MseI	TTAA	2 cut(s)	86, 266
MslI	CAYNNNNRTG	3 cut(s)	36, 216, 381
MspR9I	CCNGG	4 cut(s)	17, 197, 422, 483
MunI	CAATTG	1 cut(s)	465
Mva1269I	GAATGC	2 cut(s)	118, 298
MvaI	CCWGG	4 cut(s)	17, 197, 422, 483
MwoI	GCNNNNNNNGC	1 cut(s)	468
NlaIII	CATG	3 cut(s)	35, 215, 380
NlaIV	GGNNCC	2 cut(s)	14, 480
NmuCI	GTSAC	1 cut(s)	485
PctI	GAATGC	2 cut(s)	118, 298
PfeI	GAWTC	6 cut(s)	46, 63, 75, 226, 243, 255
PfoI	TCCNGGA	1 cut(s)	420
PsiI	TTATAA	1 cut(s)	513
Psp6I	CCWGG	4 cut(s)	15, 195, 420, 481
PspGI	CCWGG	4 cut(s)	15, 195, 420, 481
PspN4I	GGNNCC	2 cut(s)	14, 480
PspPI	GGNCC	1 cut(s)	193
RseI	CAYNNNNRTG	3 cut(s)	36, 216, 381
SaqAI	TTAA	2 cut(s)	86, 266
Sau96I	GGNCC	1 cut(s)	193
ScrFI	CCNGG	4 cut(s)	17, 197, 422, 483
SetI	ASST	9 cut(s)	18, 117, 128, 297, 308, 400, 454, 487, 534
SexAI	ACCWGGT	1 cut(s)	481
SfaNI	GCATC	1 cut(s)	455
SfcI	CTRYAG	2 cut(s)	93, 273
SmiMI	CAYNNNNRTG	3 cut(s)	36, 216, 381
Sse9I	AATT	3 cut(s)	465, 490, 508
SspI	AATATT	2 cut(s)	82, 262
SspMI	CTAG	1 cut(s)	399
StyD4I	CCNGG	4 cut(s)	15, 195, 420, 481
StyI	CCWWGG	1 cut(s)	457
TasI	AATT	3 cut(s)	465, 490, 508
TfiI	GAWTC	6 cut(s)	46, 63, 75, 226, 243, 255
Tru1I	TTAA	2 cut(s)	86, 266
Tru9I	TTAA	2 cut(s)	86, 266
TseFI	GTSAC	1 cut(s)	485
Tsp45I	GTSAC	1 cut(s)	485
TspDTI	ATGAA	6 cut(s)	48, 59, 134, 228, 239, 314
XcmI	CCANNNNNNNNNTGG	1 cut(s)	464
XspI	CTAG	1 cut(s)	399

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.