Rmu_sc0004521.1_g000021
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004521.1
Physical Location & Seq
Reverse (-)
88849 .. 92108
3260 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004521.1_g000021.1.cds

Sequence Viewer

Length: 3135 bp
atggaacacttgcagattggacgtcagacgcaagccatcactgcaattggtctggcggcctgtgacccctcgacaaatcaagtcatttcaatttctctggcagaaaagcagctcacaggcgtgatctcacccttcctcggaaacatttcgggcctccaggttcttgatctaacttcaaactcattcactggacatattccagctgagctgggactttgctcccaactttctctacttgctctgtatcaaaattctctttcgggttcaattccaccagaactaggaaaccttagtaatctgcagttattagatttgggtgataaccttttgagtggaagaatgccggagagcatttgcaactgtagcaacttgtctttgtttggtgcggaatttaataacctcactggcaaactcccatcaaacataggaaatcttgttaatcttgagcttcttatagcaagtggcaacaactttgtaggctcattacctgcttccatgggtaagttggcagctttcaaagaggttgatttaagtaaaaaccagttgtccggtgcaatacctagggagctagggaatctgtcaaatttagaacaactggtagtgtttgataattcctttgttggggaaatcccttctgaactaagtcggtgtaagaagcttgttaaccttgaactttacgagaatcatttcaccggaagcattccctctgagcttggaagtttggttcatttagaaacattgagattgtacaagaataggctaaactctacaattccactctccatttttcagctgaaatcattaacccatttaggactttcagaaaatgagttaactgggacaataccatccgagcttggatctttaagatcattgcaagtattgaccctgcactccaataagtttaccggagagatcccctcatccttgacaagcttgacaaatctaacatatctgtcaatgagcttaaattctctaacaggggaacttccatcaaacatagggttgctttataatcttaaaaacctctccatgaatggcaaccttcttgagggatccataccatctagtatcaccaactgtaccaatcttcaagttataagcttggcttataatagaataactggaaaaatacctcagggtctggggcagttgccgaagcttaatttcctttctgttggatccaataaattgttcggagaaatcccagatgacctcttcaattgcactagtcttctcactctagatttgggcctgaacaactttagtggttatctgaaacccggatttggaaaactttccaatctcagggttttgagagccacctccaattcatttgtcggacaaattccaccagagattggccaactaaaccaacttatcatcctcacacttgctgagaatagattctcaggtccagttccaccacagctgtctaatctctctcacctacaagggctatccctacacgataatgctttagaaggagccatccctgagaaactttttgagctaaaagagttaactgttctagagttgctgcaaaacaaactgaccggtccaattccagatactggcacaaaacttgagttgctttcatatttaaacctccaaggtaatatgctcaatggttccattccgaaaagcatggctcaccttaatcggctaacgactctggatctctctcacaatcatctctcaggacccattccagggtctgtgatctcagggatgaaaagcatgcagatatatttgaatttctcatacaatttcttggatggcagcattccagacgagcttggcatgttggaaatggtgcaggccattgacatttccaacaataatctttcagggatgattcctgtagcagtagaaggctgcaggaatttgtactctcttgatctgtcaggtaacaaactttcagggccaattcaagctgaagtttttgctaagatggacaccttcacaagcttgaacctttcaaggaatcacttagatggtgaactcccagaaaagttgacaaatctgaagcatcttagctcccttgatctttcccagaattttctgacgggagttatccgtgagagctttaccaattttaccagcttgaaacacttgaacctctctttcaatcaacttgaaggccctgttccagacaccggactattcagaagtataaatgcatccagcttggtaggaaacccggatctctgtggaaacaaactgctcaagacatgcaagaaaagttcacaccggatatccaagacaaccatgtatgttctcgtggcgcttggaataatttctctactgcttattttagtgatcattttcctaatccgcagccggttcaccaaaatgtgtaagccagaaaagattgaaaatccagaaccagagtgtgctgcagctttggcactcaagaggtttgatcaaaaggatttagaaaatgccactagtttctttagcaaagagaacattttaggcacaagcaggttgagtactgtgtacaagggtcaactggaagatgagcagatagtagccataaagagattgaatctccaggaattctcagttgagtcagataaatgcttcaatagagaaatcaagacactgagtcaactaaggcacaggaatttggtgaaggtacttggctatgcatgggagagtgggaaattaaaggccttggttctggaatacatggagaatggaaacctggagaacattatacatgaagatgggatgaatcagtggagattgacattctctcagagaatcaatattttaatctctatagcaaagtttgcatacatgaggaaaatcacaaccaaggtagacgtcttcagctttggtgtaatagtgatggagttactgacaagacaaaggccaacaggactcatggaaggaaatgggctgccaatgagcttgcaccaagtagtggagaaagcccttgcagatggatcagattcgcttcttgaagttctggacccgatgctaactttaaatatctccgaggaacaggtggcaaatgcagaagagctgctcaagctagccttgttttgcaccaaccaaaatcccgagcagcgacctatcatgaatgaggtgttgtctgctcttttgaagctgaaaaaggcaatatag

Protein Analysis

1044

Amino Acids

114.28

Weight (kDa)

5.99

Isoelectric Point (pI)

29.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 1014, 1100, 1113
AatII GACGTC 2 cut(s) 25, 2835
Acc36I ACCTGC 2 cut(s) 496, 2478
AccB7I CCANNNNNTGG 3 cut(s) 1361, 1574, 2932
AccI GTMKAC 1 cut(s) 2829
AciI CCGC 3 cut(s) 56, 386, 2338
AclWI GGATC 9 cut(s) 868, 910, 1050, 1063, 1176, 1189, 1686, 2214, 2962
AcoI YGGCCR 1 cut(s) 1363
AcuI CTGAAG 3 cut(s) 1959, 2048, 2821
AcyI GRCGYC 2 cut(s) 22, 2832
AfaI GTAC 6 cut(s) 749, 1084, 1892, 2497, 2504, 2643
AgeI ACCGGT 1 cut(s) 1556
AhdI GACNNNNNGTC 1 cut(s) 2610
AhlI ACTAGT 2 cut(s) 1229, 2450
AjnI CCWGG 4 cut(s) 156, 1711, 2556, 2709
AjuI GAANNNNNNNTTGG 2 cut(s) 1178, 1210
AleI CACNNNNGTG 1 cut(s) 119
AloI GAACNNNNNNTCC 2 cut(s) 708, 740
AlwI GGATC 9 cut(s) 868, 910, 1050, 1063, 1176, 1189, 1686, 2214, 2962
AlwNI CAGNNNCTG 3 cut(s) 1144, 1574, 1718
Ama87I CYCGRG 1 cut(s) 3071
AoxI GGCC 9 cut(s) 57, 151, 1252, 1363, 1821, 1925, 2143, 2676, 2879
AsiGI ACCGGT 1 cut(s) 1556
Asp700I GAANNNNTTC 5 cut(s) 145, 686, 1297, 1406, 2299
AspA2I CCTAGG 1 cut(s) 560
AspLEI GCGC 1 cut(s) 2290
AspS9I GGNCC 8 cut(s) 151, 1252, 1415, 1559, 1703, 1925, 2144, 2980
AsuC2I CCSGG 2 cut(s) 1284, 2204
AsuHPI GGTGA 9 cut(s) 120, 329, 682, 1066, 1439, 1646, 2012, 2341, 2647
AsuNHI GCTAGC 1 cut(s) 3043
AvaI CYCGRG 1 cut(s) 3071
AvaII GGWCC 4 cut(s) 1415, 1559, 1703, 2980
AvrII CCTAGG 1 cut(s) 560
AxyI CCTNAGG 1 cut(s) 1137
BalI TGGCCA 1 cut(s) 1365
BamHI GGATCC 2 cut(s) 1055, 1181
BauI CACGAG 1 cut(s) 2282
BbsI GAAGAC 2 cut(s) 1226, 2827
BciT130I CCWGG 4 cut(s) 158, 1713, 2558, 2711
BclI TGATCA 2 cut(s) 2322, 2425
BcnI CCSGG 2 cut(s) 1284, 2204
BcuI ACTAGT 2 cut(s) 1229, 2450
BfaI CTAG 9 cut(s) 281, 561, 569, 1068, 1230, 1244, 1532, 2451, 3044
BfmI CTRYAG 6 cut(s) 299, 361, 1863, 1879, 2400, 2787
BfoI RGCGCY 1 cut(s) 2291
BfuAI ACCTGC 2 cut(s) 496, 2478
BlnI CCTAGG 1 cut(s) 560
BlpI GCTNAGC 1 cut(s) 204
BmcAI AGTACT 1 cut(s) 2497
Bme1390I CCNGG 6 cut(s) 158, 1284, 1713, 2204, 2558, 2711
Bme18I GGWCC 4 cut(s) 1415, 1559, 1703, 2980
BmeRI GACNNNNNGTC 1 cut(s) 2610
BmeT110I CYCGRG 1 cut(s) 3071
BmgT120I GGNCC 8 cut(s) 151, 1252, 1415, 1559, 1703, 1925, 2144, 2980
BmiI GGNNCC 6 cut(s) 1057, 1183, 1489, 1633, 1705, 2982
BmrFI CCNGG 6 cut(s) 158, 1284, 1713, 2204, 2558, 2711
BmrI ACTGGG 1 cut(s) 846
BmsI GCATC 3 cut(s) 2041, 2192, 2976
BmtI GCTAGC 1 cut(s) 3047
BmuI ACTGGG 1 cut(s) 846
BpiI GAAGAC 2 cut(s) 1226, 2827
BplI GAGNNNNNCTC 2 cut(s) 905, 937
BpmI CTGGAG 3 cut(s) 140, 2540, 2732
Bpu1102I GCTNAGC 1 cut(s) 204
BpuEI CTTGAG 6 cut(s) 464, 1070, 1607, 2213, 2399, 3023
BpuMI CCSGG 2 cut(s) 1284, 2204
BsaHI GRCGYC 2 cut(s) 22, 2832
BsaJI CCNNGG 8 cut(s) 136, 495, 560, 1612, 1712, 2679, 2823, 3006
BsaWI WCCGGW 6 cut(s) 548, 692, 908, 1556, 2159, 2253
Bse118I RCCGGY 2 cut(s) 1556, 2343
Bse1I ACTGG 9 cut(s) 193, 409, 541, 600, 841, 1129, 1418, 1579, 2520
Bse21I CCTNAGG 1 cut(s) 1137
Bse3DI GCAATG 1 cut(s) 872
BseBI CCWGG 4 cut(s) 158, 1713, 2558, 2711
BseDI CCNNGG 8 cut(s) 136, 495, 560, 1612, 1712, 2679, 2823, 3006
BseGI GGATG 9 cut(s) 848, 923, 1383, 1491, 1737, 1783, 1860, 2183, 2742
BseMI GCAATG 1 cut(s) 872
BseNI ACTGG 9 cut(s) 193, 409, 541, 600, 841, 1129, 1418, 1579, 2520
BseYI CCCAGC 1 cut(s) 208
BsgI GTGCAG 2 cut(s) 875, 1838
BshFI GGCC 9 cut(s) 59, 153, 1254, 1365, 1823, 1927, 2145, 2678, 2881
BshTI ACCGGT 1 cut(s) 1556
BsiHKCI CYCGRG 1 cut(s) 3071
BslFI GGGAC 2 cut(s) 225, 853
BsmFI GGGAC 2 cut(s) 225, 853
BsmI GAATGC 3 cut(s) 345, 699, 1785
BsnI GGCC 9 cut(s) 59, 153, 1254, 1365, 1823, 1927, 2145, 2678, 2881
BsoBI CYCGRG 1 cut(s) 3071
Bsp1407I TGTACA 2 cut(s) 747, 2502
Bsp1720I GCTNAGC 1 cut(s) 204
Bsp19I CCATGG 1 cut(s) 495
BspACI CCGC 3 cut(s) 56, 386, 2338
BspANI GGCC 9 cut(s) 59, 153, 1254, 1365, 1823, 1927, 2145, 2678, 2881
BspHI TCATGA 1 cut(s) 3087
BspLI GGNNCC 6 cut(s) 1057, 1183, 1489, 1633, 1705, 2982
BspMAI CTGCAG 3 cut(s) 303, 1883, 2404
BspMI ACCTGC 2 cut(s) 496, 2478
BspOI GCTAGC 1 cut(s) 3047
BspPI GGATC 9 cut(s) 868, 910, 1050, 1063, 1176, 1189, 1686, 2214, 2962
BspQI GCTCTTC 1 cut(s) 3024
BsrDI GCAATG 1 cut(s) 872
BsrFI RCCGGY 2 cut(s) 1556, 2343
BsrGI TGTACA 2 cut(s) 747, 2502
BsrI ACTGG 9 cut(s) 193, 409, 541, 600, 841, 1129, 1418, 1579, 2520
BssAI RCCGGY 2 cut(s) 1556, 2343
BssECI CCNNGG 8 cut(s) 136, 495, 560, 1612, 1712, 2679, 2823, 3006
BssNI GRCGYC 2 cut(s) 22, 2832
BssSI CACGAG 1 cut(s) 2282
BssT1I CCWWGG 5 cut(s) 495, 560, 1612, 2679, 2823
Bst2BI CACGAG 1 cut(s) 2282
Bst2UI CCWGG 4 cut(s) 158, 1713, 2558, 2711
Bst4CI ACNGT 4 cut(s) 362, 1082, 1528, 2500
Bst6I CTCTTC 2 cut(s) 1223, 3024
BstACI GRCGYC 2 cut(s) 22, 2832
BstAPI GCANNNNNTGC 1 cut(s) 2798
BstAUI TGTACA 2 cut(s) 747, 2502
BstC8I GCNNGC 5 cut(s) 33, 1742, 1821, 2921, 3045
BstDSI CCRYGG 1 cut(s) 495
BstENI CCTNNNNNAGG 1 cut(s) 1049
BstF5I GGATG 9 cut(s) 848, 923, 1383, 1491, 1737, 1783, 1860, 2183, 2742
BstH2I RGCGCY 1 cut(s) 2291
BstHHI GCGC 1 cut(s) 2290
BstMWI GCNNNNNNNGC 5 cut(s) 41, 363, 2408, 2798, 3040
BstNI CCWGG 4 cut(s) 158, 1713, 2558, 2711
BstNSI RCATGY 3 cut(s) 1744, 1807, 2238
BstSCI CCNGG 6 cut(s) 156, 1282, 1711, 2202, 2556, 2709
BstSFI CTRYAG 6 cut(s) 299, 361, 1863, 1879, 2400, 2787
BstV2I GAAGAC 2 cut(s) 1226, 2827
BstX2I RGATCY 6 cut(s) 860, 915, 1055, 1181, 1678, 2206
BstYI RGATCY 6 cut(s) 860, 915, 1055, 1181, 1678, 2206
Bsu36I CCTNAGG 1 cut(s) 1137
BsuRI GGCC 9 cut(s) 59, 153, 1254, 1365, 1823, 1927, 2145, 2678, 2881
BtgI CCRYGG 1 cut(s) 495
BtsCI GGATG 9 cut(s) 848, 923, 1383, 1491, 1737, 1783, 1860, 2183, 2742
BtsI GCAGTG 1 cut(s) 39
BtsIMutI CAGTG 5 cut(s) 39, 186, 402, 2606, 2750
BveI ACCTGC 2 cut(s) 496, 2478
Cac8I GCNNGC 5 cut(s) 33, 1742, 1821, 2921, 3045
CaiI CAGNNNCTG 3 cut(s) 1144, 1574, 1718
CciI TCATGA 1 cut(s) 3087
CfoI GCGC 1 cut(s) 2290
Cfr10I RCCGGY 2 cut(s) 1556, 2343
Cfr13I GGNCC 8 cut(s) 151, 1252, 1415, 1559, 1703, 1925, 2144, 2980
CseI GACGC 1 cut(s) 37
Csp6I GTAC 6 cut(s) 748, 1083, 1891, 2496, 2503, 2642
CspAI ACCGGT 1 cut(s) 1556
CspCI CAANNNNNGTGG 2 cut(s) 1249, 1284
CviQI GTAC 6 cut(s) 748, 1083, 1891, 2496, 2503, 2642
DraI TTTAAA 2 cut(s) 1605, 2997
DriI GACNNNNNGTC 1 cut(s) 2610
EaeI YGGCCR 1 cut(s) 1363
Eam1104I CTCTTC 2 cut(s) 1223, 3024
Eam1105I GACNNNNNGTC 1 cut(s) 2610
EarI CTCTTC 2 cut(s) 1223, 3024
Eco130I CCWWGG 5 cut(s) 495, 560, 1612, 2679, 2823
Eco147I AGGCCT 1 cut(s) 2678
Eco32I GATATC 1 cut(s) 2259
Eco47I GGWCC 4 cut(s) 1415, 1559, 1703, 2980
Eco57I CTGAAG 3 cut(s) 1959, 2048, 2821
Eco81I CCTNAGG 1 cut(s) 1137
Eco88I CYCGRG 1 cut(s) 3071
EcoNI CCTNNNNNAGG 1 cut(s) 1049
EcoO109I RGGNCCY 2 cut(s) 1703, 2144
EcoRI GAATTC 1 cut(s) 2561
EcoRII CCWGG 4 cut(s) 156, 1711, 2556, 2709
EcoRV GATATC 1 cut(s) 2259
EcoT14I CCWWGG 5 cut(s) 495, 560, 1612, 2679, 2823
EcoT22I ATGCAT 2 cut(s) 2185, 2656
ErhI CCWWGG 5 cut(s) 495, 560, 1612, 2679, 2823
FalI AAGNNNNNCTT 4 cut(s) 1093, 1125, 3032, 3064
FaqI GGGAC 2 cut(s) 225, 853
FbaI TGATCA 2 cut(s) 2322, 2425
FblI GTMKAC 1 cut(s) 2829
FokI GGATG 9 cut(s) 835, 910, 1370, 1478, 1744, 1790, 1867, 2170, 2749
FspBI CTAG 9 cut(s) 281, 561, 569, 1068, 1230, 1244, 1532, 2451, 3044
GlaI GCGC 1 cut(s) 2289
GsaI CCCAGC 1 cut(s) 212
GsuI CTGGAG 3 cut(s) 140, 2540, 2732
HaeII RGCGCY 1 cut(s) 2291
HaeIII GGCC 9 cut(s) 59, 153, 1254, 1365, 1823, 1927, 2145, 2678, 2881
HgaI GACGC 1 cut(s) 37
HhaI GCGC 1 cut(s) 2290
Hin1I GRCGYC 2 cut(s) 22, 2832
Hin6I GCGC 1 cut(s) 2288
HinP1I GCGC 1 cut(s) 2288
HincII GTYRAC 6 cut(s) 664, 834, 1524, 2019, 2513, 2615
HindII GTYRAC 6 cut(s) 664, 834, 1524, 2019, 2513, 2615
HindIII AAGCTT 5 cut(s) 656, 934, 1102, 1160, 1969
HpaI GTTAAC 3 cut(s) 664, 834, 1524
HphI GGTGA 9 cut(s) 120, 329, 682, 1066, 1439, 1646, 2012, 2341, 2647
HpyAV CCTTC 9 cut(s) 142, 642, 1055, 1478, 1868, 1972, 2135, 2632, 2891
HpyCH4III ACNGT 4 cut(s) 362, 1082, 1528, 2500
HpyCH4IV ACGT 2 cut(s) 22, 2832
HpyF10VI GCNNNNNNNGC 5 cut(s) 41, 363, 2408, 2798, 3040
HpySE526I ACGT 2 cut(s) 22, 2832
Hsp92I GRCGYC 2 cut(s) 22, 2832
HspAI GCGC 1 cut(s) 2288
Ksp22I TGATCA 2 cut(s) 2322, 2425
KspAI GTTAAC 3 cut(s) 664, 834, 1524
LguI GCTCTTC 1 cut(s) 3024
LmnI GCTCC 4 cut(s) 224, 565, 1487, 2045
LweI GCATC 3 cut(s) 2041, 2192, 2976
MaeI CTAG 9 cut(s) 281, 561, 569, 1068, 1230, 1244, 1532, 2451, 3044
MaeII ACGT 2 cut(s) 22, 2832
MaeIII GTNAC 3 cut(s) 62, 1910, 2862
MboII GAAGA 8 cut(s) 348, 1082, 1210, 1226, 2531, 2741, 2827, 3041
MfeI CAATTG 2 cut(s) 45, 1222
MflI RGATCY 6 cut(s) 860, 915, 1055, 1181, 1678, 2206
MlsI TGGCCA 1 cut(s) 1365
MluNI TGGCCA 1 cut(s) 1365
MlyI GAGTC 4 cut(s) 1666, 2582, 2620, 2883
MmeI TCCRAC 4 cut(s) 1159, 1321, 1788, 1860
Mox20I TGGCCA 1 cut(s) 1365
Mph1103I ATGCAT 2 cut(s) 2185, 2656
MroXI GAANNNNTTC 5 cut(s) 145, 686, 1297, 1406, 2299
MscI TGGCCA 1 cut(s) 1365
MslI CAYNNNNRTG 5 cut(s) 119, 1473, 1995, 2354, 2730
Msp20I TGGCCA 1 cut(s) 1365
MspA1I CMGCKG 3 cut(s) 203, 793, 1432
MspR9I CCNGG 6 cut(s) 158, 1284, 1713, 2204, 2558, 2711
MunI CAATTG 2 cut(s) 45, 1222
Mva1269I GAATGC 3 cut(s) 345, 699, 1785
MvaI CCWGG 4 cut(s) 158, 1713, 2558, 2711
MwoI GCNNNNNNNGC 5 cut(s) 41, 363, 2408, 2798, 3040
NciI CCSGG 2 cut(s) 1284, 2204
NcoI CCATGG 1 cut(s) 495
NheI GCTAGC 1 cut(s) 3043
NlaIV GGNNCC 6 cut(s) 1057, 1183, 1489, 1633, 1705, 2982
NmuCI GTSAC 1 cut(s) 62
NsiI ATGCAT 2 cut(s) 2185, 2656
NspI RCATGY 3 cut(s) 1744, 1807, 2238
OliI CACNNNNGTG 1 cut(s) 119
PaeI GCATGC 1 cut(s) 1744
PagI TCATGA 1 cut(s) 3087
PceI AGGCCT 1 cut(s) 2678
PciSI GCTCTTC 1 cut(s) 3024
PctI GAATGC 3 cut(s) 345, 699, 1785
PdmI GAANNNNTTC 5 cut(s) 145, 686, 1297, 1406, 2299
PfeI GAWTC 9 cut(s) 574, 682, 1407, 1858, 1987, 2551, 2740, 2769, 2960
PflMI CCANNNNNTGG 3 cut(s) 1361, 1574, 2932
PfoI TCCNGGA 1 cut(s) 2556
PinAI ACCGGT 1 cut(s) 1556
PleI GAGTC 4 cut(s) 1666, 2581, 2619, 2883
PpsI GAGTC 4 cut(s) 1666, 2581, 2619, 2883
PpuMI RGGWCCY 1 cut(s) 1703
PsiI TTATAA 3 cut(s) 1014, 1100, 1113
Psp5II RGGWCCY 1 cut(s) 1703
Psp6I CCWGG 4 cut(s) 156, 1711, 2556, 2709
PspFI CCCAGC 1 cut(s) 208
PspGI CCWGG 4 cut(s) 156, 1711, 2556, 2709
PspN4I GGNNCC 6 cut(s) 1057, 1183, 1489, 1633, 1705, 2982
PspPI GGNCC 8 cut(s) 151, 1252, 1415, 1559, 1703, 1925, 2144, 2980
PspPPI RGGWCCY 1 cut(s) 1703
PstI CTGCAG 3 cut(s) 303, 1883, 2404
PstNI CAGNNNCTG 3 cut(s) 1144, 1574, 1718
PsuI RGATCY 6 cut(s) 860, 915, 1055, 1181, 1678, 2206
PvuII CAGCTG 3 cut(s) 203, 793, 1432
RsaI GTAC 6 cut(s) 749, 1084, 1892, 2497, 2504, 2643
RsaNI GTAC 6 cut(s) 748, 1083, 1891, 2496, 2503, 2642
RseI CAYNNNNRTG 5 cut(s) 119, 1473, 1995, 2354, 2730
SapI GCTCTTC 1 cut(s) 3024
Sau96I GGNCC 8 cut(s) 151, 1252, 1415, 1559, 1703, 1925, 2144, 2980
ScaI AGTACT 1 cut(s) 2497
SchI GAGTC 4 cut(s) 1666, 2582, 2620, 2883
ScrFI CCNGG 6 cut(s) 158, 1284, 1713, 2204, 2558, 2711
SfaNI GCATC 3 cut(s) 2041, 2192, 2976
SfcI CTRYAG 6 cut(s) 299, 361, 1863, 1879, 2400, 2787
SinI GGWCC 4 cut(s) 1415, 1559, 1703, 2980
SmiMI CAYNNNNRTG 5 cut(s) 119, 1473, 1995, 2354, 2730
SmlI CTYRAG 6 cut(s) 443, 1049, 1586, 2228, 2414, 3038
SmoI CTYRAG 6 cut(s) 443, 1049, 1586, 2228, 2414, 3038
SpeI ACTAGT 2 cut(s) 1229, 2450
SphI GCATGC 1 cut(s) 1744
SseBI AGGCCT 1 cut(s) 2678
SsiI CCGC 3 cut(s) 56, 386, 2338
SspI AATATT 1 cut(s) 2776
SspMI CTAG 9 cut(s) 281, 561, 569, 1068, 1230, 1244, 1532, 2451, 3044
StuI AGGCCT 1 cut(s) 2678
StyD4I CCNGG 6 cut(s) 156, 1282, 1711, 2202, 2556, 2709
StyI CCWWGG 5 cut(s) 495, 560, 1612, 2679, 2823
TaaI ACNGT 4 cut(s) 362, 1082, 1528, 2500
TaiI ACGT 2 cut(s) 25, 2835
TaqI TCGA 1 cut(s) 71
TatI WGTACW 4 cut(s) 747, 1890, 2495, 2502
TauI GCSGC 1 cut(s) 59
TfiI GAWTC 9 cut(s) 574, 682, 1407, 1858, 1987, 2551, 2740, 2769, 2960
TscAI CASTG 5 cut(s) 46, 193, 409, 2613, 2750
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 8 cut(s) 716, 1049, 1323, 1587, 1748, 2742, 2753, 3104
TspGWI ACGGA 1 cut(s) 2069
TspRI CASTG 5 cut(s) 46, 193, 409, 2613, 2750
Van91I CCANNNNNTGG 3 cut(s) 1361, 1574, 2932
VpaK11BI GGWCC 4 cut(s) 1415, 1559, 1703, 2980
XagI CCTNNNNNAGG 1 cut(s) 1049
XbaI TCTAGA 2 cut(s) 1243, 1531
XceI RCATGY 3 cut(s) 1744, 1807, 2238
XcmI CCANNNNNNNNNTGG 1 cut(s) 502
XmaJI CCTAGG 1 cut(s) 560
XmiI GTMKAC 1 cut(s) 2829
XmnI GAANNNNTTC 5 cut(s) 145, 686, 1297, 1406, 2299
XspI CTAG 9 cut(s) 281, 561, 569, 1068, 1230, 1244, 1532, 2451, 3044
ZraI GACGTC 2 cut(s) 23, 2833
ZrmI AGTACT 1 cut(s) 2497
Zsp2I ATGCAT 2 cut(s) 2185, 2656
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.