Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003555.1

Orthogroup ID

OG0006220

Physical Location & Seq

Genomic Coordinates Forward (+)

18279 .. 20286

Gene Structure 2008 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003555.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1089 bp

atgaatgagaagcagctgagttctttagattcctactttgaaaaactccaaaatagcacaactttgcctccagaaaattcaagcaagacaactgagtcactcggtagaaaaaatggtcatttgggattggaggaggagttggagtatcttgatgcttatcttgaaaaacttgataaagatgcaaaccagattgaaaaaccagttgatcttgcaactggagacaatatagttccaaaatcatcatctatcattcaacaatccaaaagaggtgctgaaaggaaactggtcaagagctatacaaatacaactggtgataatggtcaagatagcgaaatctctgatctctacccagtaagcatattgggttctataaacattgcagtttttctgtttgagctagcaagtccagttaggaattctgacttggagcttttttctcttccattgttatatggagcaaagataaatgatttgatcctggtcggagaatggtggaggctagtcacaccgatgtttctgcatgctggacttattcatatagctattggttcttggggacttgttacatttggacctaaggtgtgcagaggctatggttcattcacatttttcttgatatatatacttggaggaatctctggcaatttgattagctttctccacacaccagaaccaactgttggtggaacgggaccaatatttgccatgatcggagcttggctcatttatgagacccaaaacaaagatataattgcaagggaagtctcagagactatgttccaaaaggcaataataactacagctcttaccttcacagtgagcagttttggtccaattgatgactggacacattttggagctgcattgacaggaatagcatatgggtttttgacatgcccaagtcttcaactggacgaagcatcatcatcttcaacaagtggccaagaggaaggaatcacacttgttaggcgttatgctgatccctgcaaatcactttttctcttcacagtgtttgttcttgttctcagttctctacttctctttgttgaacctccactcaacgccttagcatcagactcttctgtgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rhomboid

Protein Analysis

362

Amino Acids

39.57

Weight (kDa)

4.77

Isoelectric Point (pI)

36.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006220)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G38510 AT5G38510 AT5G38510
fragaria_vesca	FvH4_6g45321 FvH4_6g45321 FvH4_6g45321
malus_domestica	MD09G1085700.v1.1 MD17G1074600.v1.1
prunus_persica	Prupe.3G239300_v2.0.a1
pyrus_communis	pycom09g01080 pycom09g01090 pycom17g07540
rosa_chinensis	RchiOBHm_Chr2g0163101
rosa_laevigata	RLG00000021373
rosa_multiflora	Rmu_sc0003555.1_g000002 Rmu_sc0003984.1_g000017
rosa_roxburghii	Rroxscaffold_2G00087550
rosa_rugosa	Rorug02G0500400 Rorug02G0500500 Rorug02G0500500 Rorug02G0500500 Rorug02G0500500
rosa_samantha	Rh2AG566800 Rh2BG579100 Rh2CG549000 Rh2DG589400
rosa_wichuraiana	Rw2G046930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	94
AccB7I	CCANNNNNTGG	1 cut(s)	680
AclWI	GGATC	2 cut(s)	469, 974
AcoI	YGGCCR	1 cut(s)	940
AcsI	RAATTY	2 cut(s)	76, 415
AfiI	CCNNNNNNNGG	1 cut(s)	680
AgsI	TTSAA	8 cut(s)	41, 81, 164, 194, 254, 908, 933, 1049
AjnI	CCWGG	1 cut(s)	477
AjuI	GAANNNNNNNTTGG	4 cut(s)	407, 439, 663, 695
AluBI	AGCT	9 cut(s)	16, 294, 397, 430, 542, 654, 716, 803, 860
AluI	AGCT	9 cut(s)	16, 294, 397, 430, 542, 654, 716, 803, 860
Alw26I	GTCTC	4 cut(s)	213, 725, 764, 769
AlwI	GGATC	2 cut(s)	469, 974
AoxI	GGCC	1 cut(s)	940
ApeKI	GCWGC	2 cut(s)	13, 860
ApoI	RAATTY	2 cut(s)	76, 415
AspS9I	GGNCC	3 cut(s)	572, 692, 830
AsuHPI	GGTGA	1 cut(s)	323
AsuNHI	GCTAGC	1 cut(s)	397
AvaII	GGWCC	3 cut(s)	572, 692, 830
AxyI	CCTNAGG	1 cut(s)	576
BalI	TGGCCA	1 cut(s)	942
BbsI	GAAGAC	1 cut(s)	896
BbvI	GCAGC	2 cut(s)	25, 847
BcgI	CGANNNNNNTGC	2 cut(s)	499, 533
BciT130I	CCWGG	1 cut(s)	479
BcoDI	GTCTC	4 cut(s)	213, 725, 764, 769
BfaI	CTAG	2 cut(s)	398, 500
BfmI	CTRYAG	1 cut(s)	798
BisI	GCNGC	2 cut(s)	14, 861
BlsI	GCNGC	2 cut(s)	15, 862
Bme1390I	CCNGG	1 cut(s)	479
Bme18I	GGWCC	3 cut(s)	572, 692, 830
BmgT120I	GGNCC	3 cut(s)	572, 692, 830
BmiI	GGNNCC	1 cut(s)	693
BmrFI	CCNGG	1 cut(s)	479
BmrI	ACTGGG	1 cut(s)	344
BmsI	GCATC	4 cut(s)	142, 169, 929, 1079
BmtI	GCTAGC	1 cut(s)	401
BmuI	ACTGGG	1 cut(s)	344
BpiI	GAAGAC	1 cut(s)	896
BplI	GAGNNNNNCTC	2 cut(s)	705, 737
BpmI	CTGGAG	2 cut(s)	54, 237
Bpu10I	CCTNAGC	1 cut(s)	1066
BsaBI	GATNNNNATC	1 cut(s)	156
BsaI	GGTCTC	1 cut(s)	725
BsaXI	ACNNNNNCTCC	6 cut(s)	52, 82, 122, 128, 152, 158
Bsc4I	CCNNNNNNNGG	1 cut(s)	680
Bse1I	ACTGG	8 cut(s)	200, 220, 288, 313, 350, 407, 848, 915
Bse21I	CCTNAGG	1 cut(s)	576
Bse3DI	GCAATG	1 cut(s)	375
Bse8I	GATNNNNATC	1 cut(s)	156
BseBI	CCWGG	1 cut(s)	479
BseJI	GATNNNNATC	1 cut(s)	156
BseLI	CCNNNNNNNGG	1 cut(s)	680
BseMI	GCAATG	1 cut(s)	375
BseMII	CTCAG	4 cut(s)	8, 84, 780, 1039
BseNI	ACTGG	8 cut(s)	200, 220, 288, 313, 350, 407, 848, 915
BseRI	GAGGAG	2 cut(s)	146, 149
BseXI	GCAGC	2 cut(s)	25, 847
BsgI	GTGCAG	1 cut(s)	604
BshFI	GGCC	1 cut(s)	942
BslFI	GGGAC	2 cut(s)	570, 705
BslI	CCNNNNNNNGG	1 cut(s)	680
BsmAI	GTCTC	4 cut(s)	213, 725, 764, 769
BsmFI	GGGAC	2 cut(s)	570, 705
BsnI	GGCC	1 cut(s)	942
Bso31I	GGTCTC	1 cut(s)	725
Bsp143I	GATC	5 cut(s)	205, 340, 474, 708, 979
BspANI	GGCC	1 cut(s)	942
BspCNI	CTCAG	4 cut(s)	9, 85, 779, 1038
BspLI	GGNNCC	1 cut(s)	693
BspOI	GCTAGC	1 cut(s)	401
BspPI	GGATC	2 cut(s)	469, 974
BspTNI	GGTCTC	1 cut(s)	725
BsrDI	GCAATG	1 cut(s)	375
BsrI	ACTGG	8 cut(s)	200, 220, 288, 313, 350, 407, 848, 915
BssMI	GATC	5 cut(s)	205, 340, 474, 708, 979
Bst2UI	CCWGG	1 cut(s)	479
Bst4CI	ACNGT	3 cut(s)	679, 817, 1009
Bst6I	CTCTTC	3 cut(s)	444, 1007, 1084
BstC8I	GCNNGC	2 cut(s)	399, 522
BstDEI	CTNAG	6 cut(s)	17, 93, 576, 766, 1025, 1066
BstKTI	GATC	5 cut(s)	208, 343, 477, 711, 982
BstMAI	GTCTC	4 cut(s)	213, 725, 764, 769
BstMBI	GATC	5 cut(s)	205, 340, 474, 708, 979
BstNI	CCWGG	1 cut(s)	479
BstNSI	RCATGY	2 cut(s)	524, 897
BstSCI	CCNGG	1 cut(s)	477
BstSFI	CTRYAG	1 cut(s)	798
BstV1I	GCAGC	2 cut(s)	25, 847
BstV2I	GAAGAC	1 cut(s)	896
Bsu36I	CCTNAGG	1 cut(s)	576
BsuRI	GGCC	1 cut(s)	942
BtsIMutI	CAGTG	2 cut(s)	822, 1014
Cac8I	GCNNGC	2 cut(s)	399, 522
Cfr13I	GGNCC	3 cut(s)	572, 692, 830
CviAII	CATG	3 cut(s)	521, 706, 894
DdeI	CTNAG	6 cut(s)	17, 93, 576, 766, 1025, 1066
DpnI	GATC	5 cut(s)	207, 342, 476, 710, 981
DpnII	GATC	5 cut(s)	205, 340, 474, 708, 979
DrdI	GACNNNNNNGTC	1 cut(s)	94
DseDI	GACNNNNNNGTC	1 cut(s)	94
EaeI	YGGCCR	1 cut(s)	940
Eam1104I	CTCTTC	3 cut(s)	444, 1007, 1084
EarI	CTCTTC	3 cut(s)	444, 1007, 1084
Eco31I	GGTCTC	1 cut(s)	725
Eco47I	GGWCC	3 cut(s)	572, 692, 830
Eco81I	CCTNAGG	1 cut(s)	576
EcoRI	GAATTC	1 cut(s)	415
EcoRII	CCWGG	1 cut(s)	477
FaeI	CATG	3 cut(s)	524, 709, 897
FaqI	GGGAC	2 cut(s)	570, 705
FatI	CATG	3 cut(s)	520, 705, 893
FauNDI	CATATG	1 cut(s)	880
Fnu4HI	GCNGC	2 cut(s)	14, 861
Fsp4HI	GCNGC	2 cut(s)	14, 861
FspBI	CTAG	2 cut(s)	398, 500
GluI	GCNGC	2 cut(s)	14, 861
GsuI	CTGGAG	2 cut(s)	54, 237
HaeIII	GGCC	1 cut(s)	942
Hin1II	CATG	3 cut(s)	524, 709, 897
HinfI	GANTC	5 cut(s)	29, 95, 633, 954, 1076
HphI	GGTGA	1 cut(s)	323
Hpy188I	TCNGA	6 cut(s)	340, 421, 485, 713, 769, 1075
Hpy188III	TCNNGA	6 cut(s)	71, 149, 161, 289, 323, 613
HpyAV	CCTTC	2 cut(s)	820, 944
HpyCH4III	ACNGT	3 cut(s)	679, 817, 1009
HpyCH4V	TGCA	8 cut(s)	182, 212, 380, 520, 585, 755, 863, 987
HpyF3I	CTNAG	6 cut(s)	17, 93, 576, 766, 1025, 1066
Hsp92II	CATG	3 cut(s)	524, 709, 897
Kzo9I	GATC	5 cut(s)	205, 340, 474, 708, 979
LmnI	GCTCC	4 cut(s)	427, 455, 713, 857
Lsp1109I	GCAGC	2 cut(s)	25, 847
LweI	GCATC	4 cut(s)	142, 169, 929, 1079
MaeI	CTAG	2 cut(s)	398, 500
MaeIII	GTNAC	3 cut(s)	96, 502, 562
MalI	GATC	5 cut(s)	207, 342, 476, 710, 981
MboI	GATC	5 cut(s)	205, 340, 474, 708, 979
MboII	GAAGA	5 cut(s)	431, 896, 921, 994, 1071
MfeI	CAATTG	1 cut(s)	834
MlsI	TGGCCA	1 cut(s)	942
MluCI	AATT	5 cut(s)	76, 415, 643, 750, 834
MluNI	TGGCCA	1 cut(s)	942
MlyI	GAGTC	2 cut(s)	104, 1070
MmeI	TCCRAC	2 cut(s)	120, 463
MnlI	CCTC	9 cut(s)	78, 124, 127, 260, 489, 581, 623, 940, 1062
Mox20I	TGGCCA	1 cut(s)	942
MscI	TGGCCA	1 cut(s)	942
MslI	CAYNNNNRTG	1 cut(s)	509
Msp20I	TGGCCA	1 cut(s)	942
MspA1I	CMGCKG	1 cut(s)	16
MspR9I	CCNGG	1 cut(s)	479
MunI	CAATTG	1 cut(s)	834
MvaI	CCWGG	1 cut(s)	479
NdeI	CATATG	1 cut(s)	880
NdeII	GATC	5 cut(s)	205, 340, 474, 708, 979
NheI	GCTAGC	1 cut(s)	397
NlaIII	CATG	3 cut(s)	524, 709, 897
NlaIV	GGNNCC	1 cut(s)	693
NmuCI	GTSAC	2 cut(s)	96, 502
NspI	RCATGY	2 cut(s)	524, 897
PaeI	GCATGC	1 cut(s)	524
PfeI	GAWTC	3 cut(s)	29, 633, 954
PflMI	CCANNNNNTGG	1 cut(s)	680
PkrI	GCNGC	2 cut(s)	15, 862
PleI	GAGTC	2 cut(s)	103, 1070
PpsI	GAGTC	2 cut(s)	103, 1070
Psp6I	CCWGG	1 cut(s)	477
PspGI	CCWGG	1 cut(s)	477
PspN4I	GGNNCC	1 cut(s)	693
PspPI	GGNCC	3 cut(s)	572, 692, 830
PvuII	CAGCTG	1 cut(s)	16
RseI	CAYNNNNRTG	1 cut(s)	509
SatI	GCNGC	2 cut(s)	14, 861
Sau3AI	GATC	5 cut(s)	205, 340, 474, 708, 979
Sau96I	GGNCC	3 cut(s)	572, 692, 830
SchI	GAGTC	2 cut(s)	104, 1070
ScrFI	CCNGG	1 cut(s)	479
SfaNI	GCATC	4 cut(s)	142, 169, 929, 1079
SfcI	CTRYAG	1 cut(s)	798
SinI	GGWCC	3 cut(s)	572, 692, 830
SmiMI	CAYNNNNRTG	1 cut(s)	509
SphI	GCATGC	1 cut(s)	524
Sse9I	AATT	5 cut(s)	76, 415, 643, 750, 834
SspI	AATATT	1 cut(s)	699
SspMI	CTAG	2 cut(s)	398, 500
StyD4I	CCNGG	1 cut(s)	477
TaaI	ACNGT	3 cut(s)	679, 817, 1009
TasI	AATT	5 cut(s)	76, 415, 643, 750, 834
TfiI	GAWTC	3 cut(s)	29, 633, 954
TscAI	CASTG	2 cut(s)	822, 1014
TseFI	GTSAC	2 cut(s)	96, 502
TseI	GCWGC	2 cut(s)	13, 860
Tsp45I	GTSAC	2 cut(s)	96, 502
TspDTI	ATGAA	3 cut(s)	17, 524, 588
TspRI	CASTG	2 cut(s)	822, 1014
Van91I	CCANNNNNTGG	1 cut(s)	680
VpaK11BI	GGWCC	3 cut(s)	572, 692, 830
XapI	RAATTY	2 cut(s)	76, 415
XceI	RCATGY	2 cut(s)	524, 897
XcmI	CCANNNNNNNNNTGG	1 cut(s)	840
XspI	CTAG	2 cut(s)	398, 500

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.