Rmu_sc0003555.1_g000002

Rhomboid family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003555.1
Physical Location & Seq
Forward (+)
18279 .. 20286
2008 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003555.1_g000002.1.cds

Sequence Viewer

Length: 1089 bp
atgaatgagaagcagctgagttctttagattcctactttgaaaaactccaaaatagcacaactttgcctccagaaaattcaagcaagacaactgagtcactcggtagaaaaaatggtcatttgggattggaggaggagttggagtatcttgatgcttatcttgaaaaacttgataaagatgcaaaccagattgaaaaaccagttgatcttgcaactggagacaatatagttccaaaatcatcatctatcattcaacaatccaaaagaggtgctgaaaggaaactggtcaagagctatacaaatacaactggtgataatggtcaagatagcgaaatctctgatctctacccagtaagcatattgggttctataaacattgcagtttttctgtttgagctagcaagtccagttaggaattctgacttggagcttttttctcttccattgttatatggagcaaagataaatgatttgatcctggtcggagaatggtggaggctagtcacaccgatgtttctgcatgctggacttattcatatagctattggttcttggggacttgttacatttggacctaaggtgtgcagaggctatggttcattcacatttttcttgatatatatacttggaggaatctctggcaatttgattagctttctccacacaccagaaccaactgttggtggaacgggaccaatatttgccatgatcggagcttggctcatttatgagacccaaaacaaagatataattgcaagggaagtctcagagactatgttccaaaaggcaataataactacagctcttaccttcacagtgagcagttttggtccaattgatgactggacacattttggagctgcattgacaggaatagcatatgggtttttgacatgcccaagtcttcaactggacgaagcatcatcatcttcaacaagtggccaagaggaaggaatcacacttgttaggcgttatgctgatccctgcaaatcactttttctcttcacagtgtttgttcttgttctcagttctctacttctctttgttgaacctccactcaacgccttagcatcagactcttctgtgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

362

Amino Acids

39.57

Weight (kDa)

4.77

Isoelectric Point (pI)

36.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 94
AccB7I CCANNNNNTGG 1 cut(s) 680
AclWI GGATC 2 cut(s) 469, 974
AcoI YGGCCR 1 cut(s) 940
AcsI RAATTY 2 cut(s) 76, 415
AfiI CCNNNNNNNGG 1 cut(s) 680
AgsI TTSAA 8 cut(s) 41, 81, 164, 194, 254, 908, 933, 1049
AjnI CCWGG 1 cut(s) 477
AjuI GAANNNNNNNTTGG 4 cut(s) 407, 439, 663, 695
AluBI AGCT 9 cut(s) 16, 294, 397, 430, 542, 654, 716, 803, 860
AluI AGCT 9 cut(s) 16, 294, 397, 430, 542, 654, 716, 803, 860
Alw26I GTCTC 4 cut(s) 213, 725, 764, 769
AlwI GGATC 2 cut(s) 469, 974
AoxI GGCC 1 cut(s) 940
ApeKI GCWGC 2 cut(s) 13, 860
ApoI RAATTY 2 cut(s) 76, 415
AspS9I GGNCC 3 cut(s) 572, 692, 830
AsuHPI GGTGA 1 cut(s) 323
AsuNHI GCTAGC 1 cut(s) 397
AvaII GGWCC 3 cut(s) 572, 692, 830
AxyI CCTNAGG 1 cut(s) 576
BalI TGGCCA 1 cut(s) 942
BbsI GAAGAC 1 cut(s) 896
BbvI GCAGC 2 cut(s) 25, 847
BcgI CGANNNNNNTGC 2 cut(s) 499, 533
BciT130I CCWGG 1 cut(s) 479
BcoDI GTCTC 4 cut(s) 213, 725, 764, 769
BfaI CTAG 2 cut(s) 398, 500
BfmI CTRYAG 1 cut(s) 798
BisI GCNGC 2 cut(s) 14, 861
BlsI GCNGC 2 cut(s) 15, 862
Bme1390I CCNGG 1 cut(s) 479
Bme18I GGWCC 3 cut(s) 572, 692, 830
BmgT120I GGNCC 3 cut(s) 572, 692, 830
BmiI GGNNCC 1 cut(s) 693
BmrFI CCNGG 1 cut(s) 479
BmrI ACTGGG 1 cut(s) 344
BmsI GCATC 4 cut(s) 142, 169, 929, 1079
BmtI GCTAGC 1 cut(s) 401
BmuI ACTGGG 1 cut(s) 344
BpiI GAAGAC 1 cut(s) 896
BplI GAGNNNNNCTC 2 cut(s) 705, 737
BpmI CTGGAG 2 cut(s) 54, 237
Bpu10I CCTNAGC 1 cut(s) 1066
BsaBI GATNNNNATC 1 cut(s) 156
BsaI GGTCTC 1 cut(s) 725
BsaXI ACNNNNNCTCC 6 cut(s) 52, 82, 122, 128, 152, 158
Bsc4I CCNNNNNNNGG 1 cut(s) 680
Bse1I ACTGG 8 cut(s) 200, 220, 288, 313, 350, 407, 848, 915
Bse21I CCTNAGG 1 cut(s) 576
Bse3DI GCAATG 1 cut(s) 375
Bse8I GATNNNNATC 1 cut(s) 156
BseBI CCWGG 1 cut(s) 479
BseJI GATNNNNATC 1 cut(s) 156
BseLI CCNNNNNNNGG 1 cut(s) 680
BseMI GCAATG 1 cut(s) 375
BseMII CTCAG 4 cut(s) 8, 84, 780, 1039
BseNI ACTGG 8 cut(s) 200, 220, 288, 313, 350, 407, 848, 915
BseRI GAGGAG 2 cut(s) 146, 149
BseXI GCAGC 2 cut(s) 25, 847
BsgI GTGCAG 1 cut(s) 604
BshFI GGCC 1 cut(s) 942
BslFI GGGAC 2 cut(s) 570, 705
BslI CCNNNNNNNGG 1 cut(s) 680
BsmAI GTCTC 4 cut(s) 213, 725, 764, 769
BsmFI GGGAC 2 cut(s) 570, 705
BsnI GGCC 1 cut(s) 942
Bso31I GGTCTC 1 cut(s) 725
Bsp143I GATC 5 cut(s) 205, 340, 474, 708, 979
BspANI GGCC 1 cut(s) 942
BspCNI CTCAG 4 cut(s) 9, 85, 779, 1038
BspLI GGNNCC 1 cut(s) 693
BspOI GCTAGC 1 cut(s) 401
BspPI GGATC 2 cut(s) 469, 974
BspTNI GGTCTC 1 cut(s) 725
BsrDI GCAATG 1 cut(s) 375
BsrI ACTGG 8 cut(s) 200, 220, 288, 313, 350, 407, 848, 915
BssMI GATC 5 cut(s) 205, 340, 474, 708, 979
Bst2UI CCWGG 1 cut(s) 479
Bst4CI ACNGT 3 cut(s) 679, 817, 1009
Bst6I CTCTTC 3 cut(s) 444, 1007, 1084
BstC8I GCNNGC 2 cut(s) 399, 522
BstDEI CTNAG 6 cut(s) 17, 93, 576, 766, 1025, 1066
BstKTI GATC 5 cut(s) 208, 343, 477, 711, 982
BstMAI GTCTC 4 cut(s) 213, 725, 764, 769
BstMBI GATC 5 cut(s) 205, 340, 474, 708, 979
BstNI CCWGG 1 cut(s) 479
BstNSI RCATGY 2 cut(s) 524, 897
BstSCI CCNGG 1 cut(s) 477
BstSFI CTRYAG 1 cut(s) 798
BstV1I GCAGC 2 cut(s) 25, 847
BstV2I GAAGAC 1 cut(s) 896
Bsu36I CCTNAGG 1 cut(s) 576
BsuRI GGCC 1 cut(s) 942
BtsIMutI CAGTG 2 cut(s) 822, 1014
Cac8I GCNNGC 2 cut(s) 399, 522
Cfr13I GGNCC 3 cut(s) 572, 692, 830
CviAII CATG 3 cut(s) 521, 706, 894
DdeI CTNAG 6 cut(s) 17, 93, 576, 766, 1025, 1066
DpnI GATC 5 cut(s) 207, 342, 476, 710, 981
DpnII GATC 5 cut(s) 205, 340, 474, 708, 979
DrdI GACNNNNNNGTC 1 cut(s) 94
DseDI GACNNNNNNGTC 1 cut(s) 94
EaeI YGGCCR 1 cut(s) 940
Eam1104I CTCTTC 3 cut(s) 444, 1007, 1084
EarI CTCTTC 3 cut(s) 444, 1007, 1084
Eco31I GGTCTC 1 cut(s) 725
Eco47I GGWCC 3 cut(s) 572, 692, 830
Eco81I CCTNAGG 1 cut(s) 576
EcoRI GAATTC 1 cut(s) 415
EcoRII CCWGG 1 cut(s) 477
FaeI CATG 3 cut(s) 524, 709, 897
FaqI GGGAC 2 cut(s) 570, 705
FatI CATG 3 cut(s) 520, 705, 893
FauNDI CATATG 1 cut(s) 880
Fnu4HI GCNGC 2 cut(s) 14, 861
Fsp4HI GCNGC 2 cut(s) 14, 861
FspBI CTAG 2 cut(s) 398, 500
GluI GCNGC 2 cut(s) 14, 861
GsuI CTGGAG 2 cut(s) 54, 237
HaeIII GGCC 1 cut(s) 942
Hin1II CATG 3 cut(s) 524, 709, 897
HinfI GANTC 5 cut(s) 29, 95, 633, 954, 1076
HphI GGTGA 1 cut(s) 323
Hpy188I TCNGA 6 cut(s) 340, 421, 485, 713, 769, 1075
Hpy188III TCNNGA 6 cut(s) 71, 149, 161, 289, 323, 613
HpyAV CCTTC 2 cut(s) 820, 944
HpyCH4III ACNGT 3 cut(s) 679, 817, 1009
HpyCH4V TGCA 8 cut(s) 182, 212, 380, 520, 585, 755, 863, 987
HpyF3I CTNAG 6 cut(s) 17, 93, 576, 766, 1025, 1066
Hsp92II CATG 3 cut(s) 524, 709, 897
Kzo9I GATC 5 cut(s) 205, 340, 474, 708, 979
LmnI GCTCC 4 cut(s) 427, 455, 713, 857
Lsp1109I GCAGC 2 cut(s) 25, 847
LweI GCATC 4 cut(s) 142, 169, 929, 1079
MaeI CTAG 2 cut(s) 398, 500
MaeIII GTNAC 3 cut(s) 96, 502, 562
MalI GATC 5 cut(s) 207, 342, 476, 710, 981
MboI GATC 5 cut(s) 205, 340, 474, 708, 979
MboII GAAGA 5 cut(s) 431, 896, 921, 994, 1071
MfeI CAATTG 1 cut(s) 834
MlsI TGGCCA 1 cut(s) 942
MluCI AATT 5 cut(s) 76, 415, 643, 750, 834
MluNI TGGCCA 1 cut(s) 942
MlyI GAGTC 2 cut(s) 104, 1070
MmeI TCCRAC 2 cut(s) 120, 463
MnlI CCTC 9 cut(s) 78, 124, 127, 260, 489, 581, 623, 940, 1062
Mox20I TGGCCA 1 cut(s) 942
MscI TGGCCA 1 cut(s) 942
MslI CAYNNNNRTG 1 cut(s) 509
Msp20I TGGCCA 1 cut(s) 942
MspA1I CMGCKG 1 cut(s) 16
MspR9I CCNGG 1 cut(s) 479
MunI CAATTG 1 cut(s) 834
MvaI CCWGG 1 cut(s) 479
NdeI CATATG 1 cut(s) 880
NdeII GATC 5 cut(s) 205, 340, 474, 708, 979
NheI GCTAGC 1 cut(s) 397
NlaIII CATG 3 cut(s) 524, 709, 897
NlaIV GGNNCC 1 cut(s) 693
NmuCI GTSAC 2 cut(s) 96, 502
NspI RCATGY 2 cut(s) 524, 897
PaeI GCATGC 1 cut(s) 524
PfeI GAWTC 3 cut(s) 29, 633, 954
PflMI CCANNNNNTGG 1 cut(s) 680
PkrI GCNGC 2 cut(s) 15, 862
PleI GAGTC 2 cut(s) 103, 1070
PpsI GAGTC 2 cut(s) 103, 1070
Psp6I CCWGG 1 cut(s) 477
PspGI CCWGG 1 cut(s) 477
PspN4I GGNNCC 1 cut(s) 693
PspPI GGNCC 3 cut(s) 572, 692, 830
PvuII CAGCTG 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 509
SatI GCNGC 2 cut(s) 14, 861
Sau3AI GATC 5 cut(s) 205, 340, 474, 708, 979
Sau96I GGNCC 3 cut(s) 572, 692, 830
SchI GAGTC 2 cut(s) 104, 1070
ScrFI CCNGG 1 cut(s) 479
SfaNI GCATC 4 cut(s) 142, 169, 929, 1079
SfcI CTRYAG 1 cut(s) 798
SinI GGWCC 3 cut(s) 572, 692, 830
SmiMI CAYNNNNRTG 1 cut(s) 509
SphI GCATGC 1 cut(s) 524
Sse9I AATT 5 cut(s) 76, 415, 643, 750, 834
SspI AATATT 1 cut(s) 699
SspMI CTAG 2 cut(s) 398, 500
StyD4I CCNGG 1 cut(s) 477
TaaI ACNGT 3 cut(s) 679, 817, 1009
TasI AATT 5 cut(s) 76, 415, 643, 750, 834
TfiI GAWTC 3 cut(s) 29, 633, 954
TscAI CASTG 2 cut(s) 822, 1014
TseFI GTSAC 2 cut(s) 96, 502
TseI GCWGC 2 cut(s) 13, 860
Tsp45I GTSAC 2 cut(s) 96, 502
TspDTI ATGAA 3 cut(s) 17, 524, 588
TspRI CASTG 2 cut(s) 822, 1014
Van91I CCANNNNNTGG 1 cut(s) 680
VpaK11BI GGWCC 3 cut(s) 572, 692, 830
XapI RAATTY 2 cut(s) 76, 415
XceI RCATGY 2 cut(s) 524, 897
XcmI CCANNNNNNNNNTGG 1 cut(s) 840
XspI CTAG 2 cut(s) 398, 500
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.