Rh2CG549000

Rhomboid family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0006220
Physical Location & Seq
Reverse (-)
72922089 .. 72925977
3889 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG549000.1

Sequence Viewer

Length: 903 bp
ATGGCTTTGGTTCCAATATGCTACAGGATACCATACAAAGGGCATATTCAACCCATACGTAATGTAATAAGCGGACCAAGTTCATCTAAAGGACTAGAAAGCCGTCTAAGATGCAGTTTAGCACATAATTCACAAGAACACAATCGTGGGATGGTTCGGTATGCATCAGATGCTAGAACGAATGAGAAGCAGCTGAGTTCTTTAGATTCCTACTTTGAAAAACTCCAAAATAGCACAACTTTGCCTCCAGAAAATTCAAGCAAGTCAACTGAGCCACTCGGTAGAAAAAATGGTCATTTGGGATTGGAGGAGGAGTTGGAGTATCTTGATGCTTATCTTGAAAAACTTAATAAAGATGCAAACCAGATTGAAAAACCAGTTGATCTTGCAACTGGAGACAATATAGTTCCAAAATCATCATCTATCATTCAACAATCCAAAAAAGGTGCTGAAAGGAAACTGGTCAAGAGCTATACAAATACAACTGGTGATAATGGTCAAGATAGCGAAATCTCTGATCTCTACCTAGTAAGCATATTGGGTTCTATAAACATTGCAGTTTTTCTTTTTGAGATAGCAAGTCCAGTTAGGAATTCTGACTTGGAGCTTTTTTCTCTTCCATTGTTATATGGAGCAAAGATAAATGATTTGATCCTGGTCGGAGAATGGTGGAGGCTAGTCACACCGATGTTTCTGCATGCTGGACTTATTCATATAGCTATTGGTTCTTGGGGACTTGTTACATTTGGACCTAAGGTGTGCAGAGGCTATGGTTCATTCACATTTTTCTTGATCTATATACTTGGAGGAATTTCTGGCAATTTGATTAGCTTTCTCCACACACCAGAACCAACTGTTGGTGGAACAGTAAGCAGCTCCTCAACTTCTATCCTTATCTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rhomboid

Protein Analysis

300

Amino Acids

32.98

Weight (kDa)

6.66

Isoelectric Point (pI)

41.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rhomboid PF01694 221 - 289 1.9e-18 Rhomboid domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 857
AciI CCGC 1 cut(s) 72
AclWI GGATC 1 cut(s) 646
AcsI RAATTY 3 cut(s) 253, 592, 810
AfiI CCNNNNNNNGG 2 cut(s) 38, 857
AgsI TTSAA 6 cut(s) 50, 218, 258, 341, 371, 431
AjnI CCWGG 1 cut(s) 654
AjuI GAANNNNNNNTTGG 4 cut(s) 584, 616, 840, 872
AleI CACNNNNGTG 1 cut(s) 144
AluBI AGCT 6 cut(s) 193, 471, 607, 719, 831, 876
AluI AGCT 6 cut(s) 193, 471, 607, 719, 831, 876
Alw26I GTCTC 1 cut(s) 390
AlwI GGATC 1 cut(s) 646
ApeKI GCWGC 2 cut(s) 190, 873
ApoI RAATTY 3 cut(s) 253, 592, 810
AspS9I GGNCC 2 cut(s) 74, 749
AsuHPI GGTGA 1 cut(s) 500
AvaII GGWCC 2 cut(s) 74, 749
AxyI CCTNAGG 1 cut(s) 753
BbvI GCAGC 2 cut(s) 202, 885
BccI CCATC 1 cut(s) 145
BceAI ACGGC 1 cut(s) 87
BcgI CGANNNNNNTGC 2 cut(s) 676, 710
BciT130I CCWGG 1 cut(s) 656
BciVI GTATCC 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 390
BfaI CTAG 4 cut(s) 95, 174, 527, 677
BfmI CTRYAG 1 cut(s) 22
BfuI GTATCC 1 cut(s) 21
BisI GCNGC 2 cut(s) 191, 874
BlsI GCNGC 2 cut(s) 192, 875
Bme1390I CCNGG 1 cut(s) 656
Bme18I GGWCC 2 cut(s) 74, 749
BmgT120I GGNCC 2 cut(s) 74, 749
BmiI GGNNCC 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 656
BmsI GCATC 5 cut(s) 101, 160, 173, 319, 346
BpmI CTGGAG 2 cut(s) 231, 414
BsaAI YACGTR 1 cut(s) 59
BsaBI GATNNNNATC 1 cut(s) 333
BsaXI ACNNNNNCTCC 6 cut(s) 229, 259, 299, 305, 329, 335
Bsc4I CCNNNNNNNGG 2 cut(s) 38, 857
Bse1I ACTGG 5 cut(s) 377, 397, 465, 490, 584
Bse21I CCTNAGG 1 cut(s) 753
Bse3DI GCAATG 1 cut(s) 552
Bse8I GATNNNNATC 1 cut(s) 333
BseBI CCWGG 1 cut(s) 656
BseGI GGATG 1 cut(s) 156
BseJI GATNNNNATC 1 cut(s) 333
BseLI CCNNNNNNNGG 2 cut(s) 38, 857
BseMI GCAATG 1 cut(s) 552
BseMII CTCAG 2 cut(s) 185, 261
BseNI ACTGG 5 cut(s) 377, 397, 465, 490, 584
BseRI GAGGAG 3 cut(s) 323, 326, 868
BseXI GCAGC 2 cut(s) 202, 885
BsgI GTGCAG 1 cut(s) 781
BslFI GGGAC 1 cut(s) 747
BslI CCNNNNNNNGG 2 cut(s) 38, 857
BsmAI GTCTC 1 cut(s) 390
BsmFI GGGAC 1 cut(s) 747
Bsp143I GATC 4 cut(s) 382, 517, 651, 792
BspACI CCGC 1 cut(s) 72
BspCNI CTCAG 2 cut(s) 186, 262
BspLI GGNNCC 1 cut(s) 12
BspPI GGATC 1 cut(s) 646
BsrDI GCAATG 1 cut(s) 552
BsrI ACTGG 5 cut(s) 377, 397, 465, 490, 584
BssMI GATC 4 cut(s) 382, 517, 651, 792
Bst2UI CCWGG 1 cut(s) 656
Bst4CI ACNGT 2 cut(s) 856, 868
Bst6I CTCTTC 1 cut(s) 621
BstAPI GCANNNNNTGC 1 cut(s) 170
BstBAI YACGTR 1 cut(s) 59
BstC8I GCNNGC 1 cut(s) 699
BstDEI CTNAG 4 cut(s) 107, 194, 270, 753
BstF5I GGATG 1 cut(s) 156
BstKTI GATC 4 cut(s) 385, 520, 654, 795
BstMAI GTCTC 1 cut(s) 390
BstMBI GATC 4 cut(s) 382, 517, 651, 792
BstMWI GCNNNNNNNGC 1 cut(s) 170
BstNI CCWGG 1 cut(s) 656
BstNSI RCATGY 1 cut(s) 701
BstSCI CCNGG 1 cut(s) 654
BstSFI CTRYAG 1 cut(s) 22
BstSNI TACGTA 1 cut(s) 59
BstV1I GCAGC 2 cut(s) 202, 885
Bsu36I CCTNAGG 1 cut(s) 753
BsuI GTATCC 1 cut(s) 21
BtsCI GGATG 1 cut(s) 156
Cac8I GCNNGC 1 cut(s) 699
Cfr13I GGNCC 2 cut(s) 74, 749
CviAII CATG 1 cut(s) 698
DdeI CTNAG 4 cut(s) 107, 194, 270, 753
DpnI GATC 4 cut(s) 384, 519, 653, 794
DpnII GATC 4 cut(s) 382, 517, 651, 792
Eam1104I CTCTTC 1 cut(s) 621
EarI CTCTTC 1 cut(s) 621
Eco105I TACGTA 1 cut(s) 59
Eco47I GGWCC 2 cut(s) 74, 749
Eco81I CCTNAGG 1 cut(s) 753
EcoRI GAATTC 1 cut(s) 592
EcoRII CCWGG 1 cut(s) 654
EcoT22I ATGCAT 1 cut(s) 166
FaeI CATG 1 cut(s) 701
FaqI GGGAC 1 cut(s) 747
FatI CATG 1 cut(s) 697
Fnu4HI GCNGC 2 cut(s) 191, 874
FokI GGATG 1 cut(s) 163
Fsp4HI GCNGC 2 cut(s) 191, 874
FspBI CTAG 4 cut(s) 95, 174, 527, 677
GluI GCNGC 2 cut(s) 191, 874
GsuI CTGGAG 2 cut(s) 231, 414
Hin1II CATG 1 cut(s) 701
HincII GTYRAC 1 cut(s) 267
HindII GTYRAC 1 cut(s) 267
HinfI GANTC 1 cut(s) 206
HphI GGTGA 1 cut(s) 500
Hpy166II GTNNAC 1 cut(s) 267
Hpy188I TCNGA 4 cut(s) 169, 517, 598, 662
Hpy188III TCNNGA 6 cut(s) 248, 326, 338, 466, 500, 790
Hpy8I GTNNAC 1 cut(s) 267
HpyCH4III ACNGT 2 cut(s) 856, 868
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 7 cut(s) 114, 164, 359, 389, 557, 697, 762
HpyF10VI GCNNNNNNNGC 1 cut(s) 170
HpyF3I CTNAG 4 cut(s) 107, 194, 270, 753
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 1 cut(s) 701
Kzo9I GATC 4 cut(s) 382, 517, 651, 792
LmnI GCTCC 3 cut(s) 604, 632, 881
Lsp1109I GCAGC 2 cut(s) 202, 885
LweI GCATC 5 cut(s) 101, 160, 173, 319, 346
MaeI CTAG 4 cut(s) 95, 174, 527, 677
MaeII ACGT 1 cut(s) 58
MaeIII GTNAC 2 cut(s) 679, 739
MalI GATC 4 cut(s) 384, 519, 653, 794
MboI GATC 4 cut(s) 382, 517, 651, 792
MboII GAAGA 1 cut(s) 608
MluCI AATT 5 cut(s) 127, 253, 592, 810, 820
MmeI TCCRAC 2 cut(s) 297, 640
MnlI CCTC 7 cut(s) 255, 301, 304, 666, 758, 800, 889
Mph1103I ATGCAT 1 cut(s) 166
MseI TTAA 2 cut(s) 348, 901
MslI CAYNNNNRTG 2 cut(s) 144, 686
MspA1I CMGCKG 1 cut(s) 193
MspR9I CCNGG 1 cut(s) 656
MvaI CCWGG 1 cut(s) 656
MwoI GCNNNNNNNGC 1 cut(s) 170
NdeII GATC 4 cut(s) 382, 517, 651, 792
NlaIII CATG 1 cut(s) 701
NlaIV GGNNCC 1 cut(s) 12
NmuCI GTSAC 1 cut(s) 679
NsiI ATGCAT 1 cut(s) 166
NspI RCATGY 1 cut(s) 701
OliI CACNNNNGTG 1 cut(s) 144
PaeI GCATGC 1 cut(s) 701
PfeI GAWTC 1 cut(s) 206
PflMI CCANNNNNTGG 1 cut(s) 857
PkrI GCNGC 2 cut(s) 192, 875
Ppu21I YACGTR 1 cut(s) 59
Psp6I CCWGG 1 cut(s) 654
PspGI CCWGG 1 cut(s) 654
PspN4I GGNNCC 1 cut(s) 12
PspPI GGNCC 2 cut(s) 74, 749
PvuII CAGCTG 1 cut(s) 193
RseI CAYNNNNRTG 2 cut(s) 144, 686
SaqAI TTAA 2 cut(s) 348, 901
SatI GCNGC 2 cut(s) 191, 874
Sau3AI GATC 4 cut(s) 382, 517, 651, 792
Sau96I GGNCC 2 cut(s) 74, 749
ScrFI CCNGG 1 cut(s) 656
SfaNI GCATC 5 cut(s) 101, 160, 173, 319, 346
SfcI CTRYAG 1 cut(s) 22
SinI GGWCC 2 cut(s) 74, 749
SmiMI CAYNNNNRTG 2 cut(s) 144, 686
SnaBI TACGTA 1 cut(s) 59
SphI GCATGC 1 cut(s) 701
Sse9I AATT 5 cut(s) 127, 253, 592, 810, 820
SsiI CCGC 1 cut(s) 72
SspMI CTAG 4 cut(s) 95, 174, 527, 677
StyD4I CCNGG 1 cut(s) 654
TaaI ACNGT 2 cut(s) 856, 868
TaiI ACGT 1 cut(s) 61
TasI AATT 5 cut(s) 127, 253, 592, 810, 820
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 2 cut(s) 348, 901
Tru9I TTAA 2 cut(s) 348, 901
TseFI GTSAC 1 cut(s) 679
TseI GCWGC 2 cut(s) 190, 873
Tsp45I GTSAC 1 cut(s) 679
TspDTI ATGAA 3 cut(s) 72, 701, 765
Van91I CCANNNNNTGG 1 cut(s) 857
VpaK11BI GGWCC 2 cut(s) 74, 749
XapI RAATTY 3 cut(s) 253, 592, 810
XceI RCATGY 1 cut(s) 701
XspI CTAG 4 cut(s) 95, 174, 527, 677
Zsp2I ATGCAT 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.