Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003594.1

Orthogroup ID

OG0013646

Physical Location & Seq

Genomic Coordinates Reverse (-)

52196 .. 52801

Gene Structure 606 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003594.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 606 bp

atgggctataataaagcttggagggcaagagaagcaacactagaaatagcaaggggatcaccagaggaatcatttgctatacttccaacatattgtgccatgttagagcgtaaaaatcaaggtacaataacacacatagaaactgatgaacagaatcaacttctatactttttcatggcaattggagcctcaattagaggatttcgtgattctatgaggcccgtgatcgctatagatggtacatttttgaaaggaaagtactttggaaccatgtttgtggctgcatgccaagatggagagaatcaaatacatcatttggcatttggggtggtagattcggaaaatgatgcttcatggtcatggtttttgaaaaaattgagaggggccattggagttgtagagaacttggtttttatcactgatcgacatggaagcattgccaaagctgtggataatgtttttcctgaagcacatcatggagcctacatctttcatatagctaacaacctgcaatcaaagtttagcaaaaaaaatgaagatccttcagttatattacacagcagcaaagtagtaccaagtatccgagttcaatacattgatggatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DBD_Tnp_Mut MULE SWIM

Protein Analysis

201

Amino Acids

22.53

Weight (kDa)

6.71

Isoelectric Point (pI)

37.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013646)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g29511 FvH4_6g24082 FvH4_7g16801 FvH4_7g16802
rosa_multiflora	Rmu_sc0003594.1_g000006 Rmu_sc0010463.1_g000007 Rmu_ssc0000404.1_g000002
rosa_roxburghii	Rroxscaffold_4G00316740
rosa_rugosa	Rorug01G0114800 Rorug02G0237500 Rorug04G0022000 Rorug04G0234800 Rorug06G0053400 Rorug06G0059100
rosa_wichuraiana	Rw0G017920 Rw0G022210 Rw1G011530 Rw5G031600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	516
AclWI	GGATC	2 cut(s)	64, 533
AcuI	CTGAAG	2 cut(s)	486, 528
AfaI	GTAC	4 cut(s)	124, 241, 260, 573
AgsI	TTSAA	3 cut(s)	250, 370, 590
AluBI	AGCT	3 cut(s)	17, 446, 500
AluI	AGCT	3 cut(s)	17, 446, 500
AlwI	GGATC	2 cut(s)	64, 533
AoxI	GGCC	2 cut(s)	218, 384
ApeKI	GCWGC	2 cut(s)	281, 561
AspS9I	GGNCC	2 cut(s)	219, 384
AsuHPI	GGTGA	1 cut(s)	51
BbvI	GCAGC	2 cut(s)	268, 573
BccI	CCATC	3 cut(s)	230, 287, 593
BciVI	GTATCC	1 cut(s)	590
BfaI	CTAG	1 cut(s)	41
BfmI	CTRYAG	1 cut(s)	231
BfuAI	ACCTGC	1 cut(s)	516
BfuI	GTATCC	1 cut(s)	590
BisI	GCNGC	2 cut(s)	282, 562
BlsI	GCNGC	2 cut(s)	283, 563
BmcAI	AGTACT	1 cut(s)	260
BmgT120I	GGNCC	2 cut(s)	219, 384
BmiI	GGNNCC	4 cut(s)	187, 268, 385, 481
BmsI	GCATC	1 cut(s)	337
Bse3DI	GCAATG	1 cut(s)	435
BseMI	GCAATG	1 cut(s)	435
BseXI	GCAGC	2 cut(s)	268, 573
BshFI	GGCC	2 cut(s)	220, 386
BsnI	GGCC	2 cut(s)	220, 386
Bsp143I	GATC	4 cut(s)	56, 225, 421, 538
BspANI	GGCC	2 cut(s)	220, 386
BspLI	GGNNCC	4 cut(s)	187, 268, 385, 481
BspMI	ACCTGC	1 cut(s)	516
BspPI	GGATC	2 cut(s)	64, 533
BsrDI	GCAATG	1 cut(s)	435
BssMI	GATC	4 cut(s)	56, 225, 421, 538
BstC8I	GCNNGC	1 cut(s)	286
BstKTI	GATC	4 cut(s)	59, 228, 424, 541
BstMBI	GATC	4 cut(s)	56, 225, 421, 538
BstMWI	GCNNNNNNNGC	3 cut(s)	23, 32, 185
BstNSI	RCATGY	1 cut(s)	288
BstSFI	CTRYAG	1 cut(s)	231
BstV1I	GCAGC	2 cut(s)	268, 573
BstX2I	RGATCY	1 cut(s)	538
BstXI	CCANNNNNNTGG	2 cut(s)	277, 448
BstYI	RGATCY	1 cut(s)	538
BsuI	GTATCC	1 cut(s)	590
BsuRI	GGCC	2 cut(s)	220, 386
BtsIMutI	CAGTG	1 cut(s)	417
BveI	ACCTGC	1 cut(s)	516
Cac8I	GCNNGC	1 cut(s)	286
Cfr13I	GGNCC	2 cut(s)	219, 384
Csp6I	GTAC	4 cut(s)	123, 240, 259, 572
CviAII	CATG	8 cut(s)	100, 175, 271, 285, 354, 360, 428, 476
CviJI	RGCY	9 cut(s)	6, 17, 188, 220, 281, 386, 446, 482, 500
CviKI_1	RGCY	9 cut(s)	6, 17, 188, 220, 281, 386, 446, 482, 500
CviQI	GTAC	4 cut(s)	123, 240, 259, 572
DpnI	GATC	4 cut(s)	58, 227, 423, 540
DpnII	GATC	4 cut(s)	56, 225, 421, 538
Eco57I	CTGAAG	2 cut(s)	486, 528
FaeI	CATG	8 cut(s)	103, 178, 274, 288, 357, 363, 431, 479
FatI	CATG	8 cut(s)	99, 174, 270, 284, 353, 359, 427, 475
Fnu4HI	GCNGC	2 cut(s)	282, 562
Fsp4HI	GCNGC	2 cut(s)	282, 562
FspBI	CTAG	1 cut(s)	41
GluI	GCNGC	2 cut(s)	282, 562
HaeIII	GGCC	2 cut(s)	220, 386
Hin1II	CATG	8 cut(s)	103, 178, 274, 288, 357, 363, 431, 479
HindIII	AAGCTT	1 cut(s)	15
HinfI	GANTC	5 cut(s)	68, 154, 209, 301, 335
HphI	GGTGA	1 cut(s)	51
Hpy188I	TCNGA	2 cut(s)	340, 584
Hpy188III	TCNNGA	2 cut(s)	206, 464
HpyAV	CCTTC	1 cut(s)	552
HpyCH4V	TGCA	2 cut(s)	284, 511
HpyF10VI	GCNNNNNNNGC	3 cut(s)	23, 32, 185
Hsp92II	CATG	8 cut(s)	103, 178, 274, 288, 357, 363, 431, 479
Kzo9I	GATC	4 cut(s)	56, 225, 421, 538
LmnI	GCTCC	2 cut(s)	185, 479
LpnPI	CCDG	3 cut(s)	75, 477, 521
Lsp1109I	GCAGC	2 cut(s)	268, 573
LweI	GCATC	1 cut(s)	337
MaeI	CTAG	1 cut(s)	41
MalI	GATC	4 cut(s)	58, 227, 423, 540
MboI	GATC	4 cut(s)	56, 225, 421, 538
MboII	GAAGA	1 cut(s)	548
MfeI	CAATTG	1 cut(s)	180
MflI	RGATCY	1 cut(s)	538
MluCI	AATT	3 cut(s)	180, 192, 374
MmeI	TCCRAC	1 cut(s)	110
MnlI	CCTC	6 cut(s)	15, 58, 191, 199, 210, 374
MslI	CAYNNNNRTG	2 cut(s)	275, 358
MunI	CAATTG	1 cut(s)	180
MwoI	GCNNNNNNNGC	3 cut(s)	23, 32, 185
NdeII	GATC	4 cut(s)	56, 225, 421, 538
NlaIII	CATG	8 cut(s)	103, 178, 274, 288, 357, 363, 431, 479
NlaIV	GGNNCC	4 cut(s)	187, 268, 385, 481
NspI	RCATGY	1 cut(s)	288
PaeI	GCATGC	1 cut(s)	288
PfeI	GAWTC	5 cut(s)	68, 154, 209, 301, 335
PkrI	GCNGC	2 cut(s)	283, 563
PspN4I	GGNNCC	4 cut(s)	187, 268, 385, 481
PspPI	GGNCC	2 cut(s)	219, 384
PsuI	RGATCY	1 cut(s)	538
RsaI	GTAC	4 cut(s)	124, 241, 260, 573
RsaNI	GTAC	4 cut(s)	123, 240, 259, 572
RseI	CAYNNNNRTG	2 cut(s)	275, 358
SatI	GCNGC	2 cut(s)	282, 562
Sau3AI	GATC	4 cut(s)	56, 225, 421, 538
Sau96I	GGNCC	2 cut(s)	219, 384
ScaI	AGTACT	1 cut(s)	260
SetI	ASST	5 cut(s)	19, 124, 448, 502, 510
SfaNI	GCATC	1 cut(s)	337
SfcI	CTRYAG	1 cut(s)	231
SmiMI	CAYNNNNRTG	2 cut(s)	275, 358
SphI	GCATGC	1 cut(s)	288
Sse9I	AATT	3 cut(s)	180, 192, 374
SspMI	CTAG	1 cut(s)	41
TaqI	TCGA	1 cut(s)	424
TasI	AATT	3 cut(s)	180, 192, 374
TatI	WGTACW	1 cut(s)	258
TfiI	GAWTC	5 cut(s)	68, 154, 209, 301, 335
TscAI	CASTG	1 cut(s)	424
TseI	GCWGC	2 cut(s)	281, 561
TspDTI	ATGAA	5 cut(s)	162, 163, 342, 482, 549
TspRI	CASTG	1 cut(s)	424
XceI	RCATGY	1 cut(s)	288
XspI	CTAG	1 cut(s)	41
ZrmI	AGTACT	1 cut(s)	260

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.