Rmu_sc0003660.1_g000005

Tubulin is the major constituent of microtubules. The gamma chain is found at microtubule organizing centers (MTOC) such as the spindle poles or the centrosome

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003660.1
Physical Location & Seq
Forward (+)
13434 .. 17164
3731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003660.1_g000005.1.cds

Sequence Viewer

Length: 270 bp
atgaagatggctttgacaagtttctttgtgccaccaaattacaagcaacaggttgcgttgtctaggaagtctccatatgtgcaaactggccacagggaaaatgacctttcagaatttgatgaatcaagagaaatacttgagtgtttggttgatgaatataaggcctgtgagtccccagattacatcaaatggggaatggaggatccagaccacgttcttacaggagaaggcaatgcagcaggaacagtggacccaaaattggcagcatga

Protein Analysis

89

Amino Acids

10.01

Weight (kDa)

4.63

Isoelectric Point (pI)

51.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 197, 210
AcoI YGGCCR 1 cut(s) 88
AcsI RAATTY 1 cut(s) 113
AfiI CCNNNNNNNGG 1 cut(s) 259
Alw26I GTCTC 1 cut(s) 75
AlwI GGATC 2 cut(s) 197, 210
AoxI GGCC 2 cut(s) 88, 162
ApeKI GCWGC 2 cut(s) 236, 263
ApoI RAATTY 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 250
AvaII GGWCC 1 cut(s) 250
BalI TGGCCA 1 cut(s) 90
BamHI GGATCC 1 cut(s) 202
BbvI GCAGC 1 cut(s) 248
BcoDI GTCTC 1 cut(s) 75
BfaI CTAG 1 cut(s) 63
BisI GCNGC 2 cut(s) 237, 264
BlsI GCNGC 2 cut(s) 238, 265
Bme18I GGWCC 1 cut(s) 250
BmgT120I GGNCC 1 cut(s) 250
BmiI GGNNCC 2 cut(s) 204, 252
BpuEI CTTGAG 1 cut(s) 158
Bsc4I CCNNNNNNNGG 1 cut(s) 259
Bse1I ACTGG 1 cut(s) 91
Bse3DI GCAATG 1 cut(s) 238
BseLI CCNNNNNNNGG 1 cut(s) 259
BseMI GCAATG 1 cut(s) 238
BseNI ACTGG 1 cut(s) 91
BseXI GCAGC 1 cut(s) 248
BshFI GGCC 2 cut(s) 90, 164
BslFI GGGAC 1 cut(s) 157
BslI CCNNNNNNNGG 1 cut(s) 259
BsmAI GTCTC 1 cut(s) 75
BsmFI GGGAC 1 cut(s) 157
BsnI GGCC 2 cut(s) 90, 164
Bsp143I GATC 1 cut(s) 202
BspANI GGCC 2 cut(s) 90, 164
BspLI GGNNCC 2 cut(s) 204, 252
BspPI GGATC 2 cut(s) 197, 210
BsrDI GCAATG 1 cut(s) 238
BsrI ACTGG 1 cut(s) 91
BssMI GATC 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 247
BstKTI GATC 1 cut(s) 205
BstMAI GTCTC 1 cut(s) 75
BstMBI GATC 1 cut(s) 202
BstV1I GCAGC 1 cut(s) 248
BstX2I RGATCY 1 cut(s) 202
BstYI RGATCY 1 cut(s) 202
BsuRI GGCC 2 cut(s) 90, 164
BtsIMutI CAGTG 1 cut(s) 252
Cfr13I GGNCC 1 cut(s) 250
CviAII CATG 1 cut(s) 267
CviJI RGCY 3 cut(s) 11, 90, 164
CviKI_1 RGCY 3 cut(s) 11, 90, 164
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
EaeI YGGCCR 1 cut(s) 88
Eco147I AGGCCT 1 cut(s) 164
Eco47I GGWCC 1 cut(s) 250
FaeI CATG 1 cut(s) 270
FaiI YATR 4 cut(s) 76, 78, 159, 268
FaqI GGGAC 1 cut(s) 157
FatI CATG 1 cut(s) 266
FauNDI CATATG 1 cut(s) 76
Fnu4HI GCNGC 2 cut(s) 237, 264
Fsp4HI GCNGC 2 cut(s) 237, 264
FspBI CTAG 1 cut(s) 63
GluI GCNGC 2 cut(s) 237, 264
HaeIII GGCC 2 cut(s) 90, 164
Hin1II CATG 1 cut(s) 270
HinfI GANTC 2 cut(s) 122, 170
Hpy166II GTNNAC 1 cut(s) 250
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 2 cut(s) 126, 206
Hpy8I GTNNAC 1 cut(s) 250
HpyAV CCTTC 1 cut(s) 221
HpyCH4III ACNGT 1 cut(s) 247
HpyCH4IV ACGT 1 cut(s) 213
HpyCH4V TGCA 2 cut(s) 82, 236
HpySE526I ACGT 1 cut(s) 213
Hsp92II CATG 1 cut(s) 270
Kzo9I GATC 1 cut(s) 202
LpnPI CCDG 8 cut(s) 35, 72, 79, 178, 189, 207, 219, 225
Lsp1109I GCAGC 1 cut(s) 248
MaeI CTAG 1 cut(s) 63
MaeII ACGT 1 cut(s) 213
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MboII GAAGA 1 cut(s) 16
MflI RGATCY 1 cut(s) 202
MlsI TGGCCA 1 cut(s) 90
MluCI AATT 3 cut(s) 37, 113, 257
MluNI TGGCCA 1 cut(s) 90
MlyI GAGTC 1 cut(s) 179
MnlI CCTC 1 cut(s) 193
Mox20I TGGCCA 1 cut(s) 90
MscI TGGCCA 1 cut(s) 90
Msp20I TGGCCA 1 cut(s) 90
NdeI CATATG 1 cut(s) 76
NdeII GATC 1 cut(s) 202
NlaIII CATG 1 cut(s) 270
NlaIV GGNNCC 2 cut(s) 204, 252
PceI AGGCCT 1 cut(s) 164
PfeI GAWTC 1 cut(s) 122
PkrI GCNGC 2 cut(s) 238, 265
PleI GAGTC 1 cut(s) 178
PpsI GAGTC 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 204, 252
PspPI GGNCC 1 cut(s) 250
PsuI RGATCY 1 cut(s) 202
SatI GCNGC 2 cut(s) 237, 264
Sau3AI GATC 1 cut(s) 202
Sau96I GGNCC 1 cut(s) 250
SchI GAGTC 1 cut(s) 179
SetI ASST 3 cut(s) 54, 108, 216
SinI GGWCC 1 cut(s) 250
SmlI CTYRAG 1 cut(s) 137
SmoI CTYRAG 1 cut(s) 137
Sse9I AATT 3 cut(s) 37, 113, 257
SseBI AGGCCT 1 cut(s) 164
SspMI CTAG 1 cut(s) 63
StuI AGGCCT 1 cut(s) 164
TaaI ACNGT 1 cut(s) 247
TaiI ACGT 1 cut(s) 216
TasI AATT 3 cut(s) 37, 113, 257
TfiI GAWTC 1 cut(s) 122
TscAI CASTG 1 cut(s) 252
TseI GCWGC 2 cut(s) 236, 263
TspDTI ATGAA 3 cut(s) 17, 135, 168
TspRI CASTG 1 cut(s) 252
VpaK11BI GGWCC 1 cut(s) 250
XapI RAATTY 1 cut(s) 113
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.