Rmu_sc0004799.1_g000013

Tubulin is the major constituent of microtubules. The gamma chain is found at microtubule organizing centers (MTOC) such as the spindle poles or the centrosome

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004799.1
Physical Location & Seq
Forward (+)
67393 .. 68683
1291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004799.1_g000013.1.cds

Sequence Viewer

Length: 240 bp
atgaaagtttgcaggggatacgttgcgttgtctaggaagtctccatatgtgcaaactggccacagggaaaatgacctttcagaatttgatgaatcaagagaaatacttgagtgtttggttgatgaatataaggcctgtgagtccccagattacatcaaatggggaatggaggatccagaccacgttcttacaggagaaggcaatgcagcaggaacagtggacccaaaattggcagcatga

Protein Analysis

79

Amino Acids

8.84

Weight (kDa)

4.63

Isoelectric Point (pI)

37.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 167, 180
AcoI YGGCCR 1 cut(s) 58
AcsI RAATTY 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 229
Alw26I GTCTC 1 cut(s) 45
AlwI GGATC 2 cut(s) 167, 180
AoxI GGCC 2 cut(s) 58, 132
ApeKI GCWGC 2 cut(s) 206, 233
ApoI RAATTY 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 220
AvaII GGWCC 1 cut(s) 220
BalI TGGCCA 1 cut(s) 60
BamHI GGATCC 1 cut(s) 172
BbvI GCAGC 1 cut(s) 218
BciVI GTATCC 1 cut(s) 11
BcoDI GTCTC 1 cut(s) 45
BfaI CTAG 1 cut(s) 33
BfuI GTATCC 1 cut(s) 11
BisI GCNGC 2 cut(s) 207, 234
BlsI GCNGC 2 cut(s) 208, 235
Bme18I GGWCC 1 cut(s) 220
BmgT120I GGNCC 1 cut(s) 220
BmiI GGNNCC 2 cut(s) 174, 222
BpuEI CTTGAG 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 229
Bse1I ACTGG 1 cut(s) 61
Bse3DI GCAATG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 229
BseMI GCAATG 1 cut(s) 208
BseNI ACTGG 1 cut(s) 61
BseXI GCAGC 1 cut(s) 218
BshFI GGCC 2 cut(s) 60, 134
BslFI GGGAC 1 cut(s) 127
BslI CCNNNNNNNGG 1 cut(s) 229
BsmAI GTCTC 1 cut(s) 45
BsmFI GGGAC 1 cut(s) 127
BsnI GGCC 2 cut(s) 60, 134
Bsp143I GATC 1 cut(s) 172
BspANI GGCC 2 cut(s) 60, 134
BspLI GGNNCC 2 cut(s) 174, 222
BspPI GGATC 2 cut(s) 167, 180
BsrDI GCAATG 1 cut(s) 208
BsrI ACTGG 1 cut(s) 61
BssMI GATC 1 cut(s) 172
Bst4CI ACNGT 1 cut(s) 217
BstKTI GATC 1 cut(s) 175
BstMAI GTCTC 1 cut(s) 45
BstMBI GATC 1 cut(s) 172
BstV1I GCAGC 1 cut(s) 218
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BsuI GTATCC 1 cut(s) 11
BsuRI GGCC 2 cut(s) 60, 134
BtsIMutI CAGTG 1 cut(s) 222
Cfr13I GGNCC 1 cut(s) 220
CviAII CATG 1 cut(s) 237
CviJI RGCY 2 cut(s) 60, 134
CviKI_1 RGCY 2 cut(s) 60, 134
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
EaeI YGGCCR 1 cut(s) 58
Eco147I AGGCCT 1 cut(s) 134
Eco47I GGWCC 1 cut(s) 220
FaeI CATG 1 cut(s) 240
FaiI YATR 4 cut(s) 46, 48, 129, 238
FaqI GGGAC 1 cut(s) 127
FatI CATG 1 cut(s) 236
FauNDI CATATG 1 cut(s) 46
Fnu4HI GCNGC 2 cut(s) 207, 234
Fsp4HI GCNGC 2 cut(s) 207, 234
FspBI CTAG 1 cut(s) 33
GluI GCNGC 2 cut(s) 207, 234
HaeIII GGCC 2 cut(s) 60, 134
Hin1II CATG 1 cut(s) 240
HinfI GANTC 2 cut(s) 92, 140
Hpy166II GTNNAC 1 cut(s) 220
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 96, 176
Hpy8I GTNNAC 1 cut(s) 220
HpyAV CCTTC 1 cut(s) 191
HpyCH4III ACNGT 1 cut(s) 217
HpyCH4IV ACGT 2 cut(s) 21, 183
HpyCH4V TGCA 3 cut(s) 12, 52, 206
HpySE526I ACGT 2 cut(s) 21, 183
Hsp92II CATG 1 cut(s) 240
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 7 cut(s) 42, 49, 148, 159, 177, 189, 195
Lsp1109I GCAGC 1 cut(s) 218
MaeI CTAG 1 cut(s) 33
MaeII ACGT 2 cut(s) 21, 183
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MflI RGATCY 1 cut(s) 172
MlsI TGGCCA 1 cut(s) 60
MluCI AATT 2 cut(s) 83, 227
MluNI TGGCCA 1 cut(s) 60
MlyI GAGTC 1 cut(s) 149
MnlI CCTC 1 cut(s) 163
Mox20I TGGCCA 1 cut(s) 60
MscI TGGCCA 1 cut(s) 60
Msp20I TGGCCA 1 cut(s) 60
NdeI CATATG 1 cut(s) 46
NdeII GATC 1 cut(s) 172
NlaIII CATG 1 cut(s) 240
NlaIV GGNNCC 2 cut(s) 174, 222
PceI AGGCCT 1 cut(s) 134
PfeI GAWTC 1 cut(s) 92
PkrI GCNGC 2 cut(s) 208, 235
PleI GAGTC 1 cut(s) 148
PpsI GAGTC 1 cut(s) 148
PspN4I GGNNCC 2 cut(s) 174, 222
PspPI GGNCC 1 cut(s) 220
PsuI RGATCY 1 cut(s) 172
SatI GCNGC 2 cut(s) 207, 234
Sau3AI GATC 1 cut(s) 172
Sau96I GGNCC 1 cut(s) 220
SchI GAGTC 1 cut(s) 149
SetI ASST 3 cut(s) 24, 78, 186
SinI GGWCC 1 cut(s) 220
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
Sse9I AATT 2 cut(s) 83, 227
SseBI AGGCCT 1 cut(s) 134
SspMI CTAG 1 cut(s) 33
StuI AGGCCT 1 cut(s) 134
TaaI ACNGT 1 cut(s) 217
TaiI ACGT 2 cut(s) 24, 186
TasI AATT 2 cut(s) 83, 227
TfiI GAWTC 1 cut(s) 92
TscAI CASTG 1 cut(s) 222
TseI GCWGC 2 cut(s) 206, 233
TspDTI ATGAA 3 cut(s) 17, 105, 138
TspRI CASTG 1 cut(s) 222
VpaK11BI GGWCC 1 cut(s) 220
XapI RAATTY 1 cut(s) 83
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.