Rmu_sc0003699.1_g000003

Pollen proteins Ole e I like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003699.1
Physical Location & Seq
Forward (+)
10814 .. 13015
2202 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003699.1_g000003.1.cds

Sequence Viewer

Length: 660 bp
atgagcgcatacttttgcagcaaccataagcttctgaggaatagcatcaacatgtactactgcaatatcttcttcttcttctgctgtctcatcacagtttcaagggcggatgatcatgatcaagtgtcagtgcagcagcaaaaccctttacaccagttactctccagccgaaaagatctggtgcagattgctggatatggagaagagaagctttctacagtactaattactggctccgtccattgtgaagaggcttgtagtctgtccgatgatcaagaacatcaagcttatcagcttcatcttcatgcatggcctgtgtcaggtgctgtggtgtctgtcaattgccgtgtgggtgggagaaaaaggaaattaagtcggtcacaaggtgtcacagatgaatatggagatttcatgattgatctaccttccgatctacacgcagttcccaacttggacaaactatgttgcgcaagagttattcgggtaccaaagaacacaaagtgcaaagcagcatttgtaaagaggcacaagggactgaaattatcatcagttggtaatggtatcagaacttacagtgctggaaggataagattccagaatttgacacctaaacctccacaagcatgcattaagaaagcaagcaacaacaaacagatgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

219

Amino Acids

24.56

Weight (kDa)

9.29

Isoelectric Point (pI)

38.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011999)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 469
Acc65I GGTACC 1 cut(s) 484
AccB1I GGYRCC 1 cut(s) 484
AciI CCGC 1 cut(s) 107
AcsI RAATTY 1 cut(s) 598
AdeI CACNNNGTG 2 cut(s) 386, 501
AfaI GTAC 3 cut(s) 56, 222, 486
AfiI CCNNNNNNNGG 1 cut(s) 320
AflIII ACRYGT 1 cut(s) 51
AgsI TTSAA 1 cut(s) 102
AluBI AGCT 4 cut(s) 31, 211, 287, 295
AluI AGCT 4 cut(s) 31, 211, 287, 295
Alw26I GTCTC 1 cut(s) 92
AlwNI CAGNNNCTG 1 cut(s) 326
AoxI GGCC 1 cut(s) 311
ApeKI GCWGC 4 cut(s) 18, 133, 136, 509
ApoI RAATTY 1 cut(s) 598
Asp718I GGTACC 1 cut(s) 484
AspLEI GCGC 2 cut(s) 8, 470
BanI GGYRCC 1 cut(s) 484
BbvI GCAGC 4 cut(s) 30, 145, 148, 521
BceAI ACGGC 1 cut(s) 330
BclI TGATCA 3 cut(s) 112, 118, 271
BcoDI GTCTC 1 cut(s) 92
BfmI CTRYAG 1 cut(s) 216
BglII AGATCT 1 cut(s) 175
BisI GCNGC 4 cut(s) 19, 134, 137, 510
BlsI GCNGC 4 cut(s) 20, 135, 138, 511
BmcAI AGTACT 1 cut(s) 222
BmiI GGNNCC 2 cut(s) 235, 486
BmsI GCATC 1 cut(s) 54
BpmI CTGGAG 1 cut(s) 148
BsaBI GATNNNNATC 1 cut(s) 117
Bsc4I CCNNNNNNNGG 1 cut(s) 320
Bse1I ACTGG 2 cut(s) 154, 235
Bse8I GATNNNNATC 1 cut(s) 117
BseGI GGATG 1 cut(s) 115
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 1 cut(s) 320
BseMII CTCAG 1 cut(s) 26
BseNI ACTGG 2 cut(s) 154, 235
BseXI GCAGC 4 cut(s) 30, 145, 148, 521
BsgI GTGCAG 2 cut(s) 152, 203
BshFI GGCC 1 cut(s) 313
BshNI GGYRCC 1 cut(s) 484
BslFI GGGAC 1 cut(s) 546
BslI CCNNNNNNNGG 1 cut(s) 320
BsmAI GTCTC 1 cut(s) 92
BsmFI GGGAC 1 cut(s) 546
BsnI GGCC 1 cut(s) 313
Bsp143I GATC 6 cut(s) 112, 118, 175, 271, 418, 430
BspACI CCGC 1 cut(s) 107
BspANI GGCC 1 cut(s) 313
BspCNI CTCAG 1 cut(s) 27
BspHI TCATGA 2 cut(s) 115, 411
BspLI GGNNCC 2 cut(s) 235, 486
BspT107I GGYRCC 1 cut(s) 484
BsrI ACTGG 2 cut(s) 154, 235
BssMI GATC 6 cut(s) 112, 118, 175, 271, 418, 430
Bst4CI ACNGT 3 cut(s) 97, 220, 575
Bst6I CTCTTC 2 cut(s) 198, 243
BstC8I GCNNGC 2 cut(s) 625, 640
BstDEI CTNAG 1 cut(s) 35
BstENI CCTNNNNNAGG 1 cut(s) 318
BstF5I GGATG 1 cut(s) 115
BstHHI GCGC 2 cut(s) 8, 470
BstKTI GATC 6 cut(s) 115, 121, 178, 274, 421, 433
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 6 cut(s) 112, 118, 175, 271, 418, 430
BstNSI RCATGY 2 cut(s) 55, 627
BstSFI CTRYAG 1 cut(s) 216
BstV1I GCAGC 4 cut(s) 30, 145, 148, 521
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
BsuRI GGCC 1 cut(s) 313
BtsCI GGATG 1 cut(s) 115
BtsIMutI CAGTG 2 cut(s) 135, 580
Cac8I GCNNGC 2 cut(s) 625, 640
CaiI CAGNNNCTG 1 cut(s) 326
CciI TCATGA 2 cut(s) 115, 411
CfoI GCGC 2 cut(s) 8, 470
Csp6I GTAC 3 cut(s) 55, 221, 485
CviAII CATG 6 cut(s) 52, 116, 305, 309, 412, 624
CviJI RGCY 8 cut(s) 31, 168, 211, 234, 254, 287, 295, 313
CviKI_1 RGCY 8 cut(s) 31, 168, 211, 234, 254, 287, 295, 313
CviQI GTAC 3 cut(s) 55, 221, 485
DdeI CTNAG 1 cut(s) 35
DpnI GATC 6 cut(s) 114, 120, 177, 273, 420, 432
DpnII GATC 6 cut(s) 112, 118, 175, 271, 418, 430
DraIII CACNNNGTG 2 cut(s) 386, 501
Eam1104I CTCTTC 2 cut(s) 198, 243
EarI CTCTTC 2 cut(s) 198, 243
EciI GGCGGA 1 cut(s) 122
EcoNI CCTNNNNNAGG 1 cut(s) 318
EcoT22I ATGCAT 2 cut(s) 310, 629
FaeI CATG 6 cut(s) 55, 119, 308, 312, 415, 627
FalI AAGNNNNNCTT 2 cut(s) 195, 227
FaqI GGGAC 1 cut(s) 546
FatI CATG 6 cut(s) 51, 115, 304, 308, 411, 623
FbaI TGATCA 3 cut(s) 112, 118, 271
Fnu4HI GCNGC 4 cut(s) 19, 134, 137, 510
FokI GGATG 1 cut(s) 122
Fsp4HI GCNGC 4 cut(s) 19, 134, 137, 510
FspI TGCGCA 1 cut(s) 469
GlaI GCGC 2 cut(s) 7, 469
GluI GCNGC 4 cut(s) 19, 134, 137, 510
GsuI CTGGAG 1 cut(s) 148
HaeIII GGCC 1 cut(s) 313
HhaI GCGC 2 cut(s) 8, 470
Hin1II CATG 6 cut(s) 55, 119, 308, 312, 415, 627
Hin6I GCGC 2 cut(s) 6, 468
HinP1I GCGC 2 cut(s) 6, 468
HindIII AAGCTT 3 cut(s) 29, 209, 285
HinfI GANTC 1 cut(s) 591
Hpy188I TCNGA 4 cut(s) 36, 268, 430, 566
Hpy188III TCNNGA 4 cut(s) 116, 275, 412, 595
HpyAV CCTTC 2 cut(s) 435, 576
HpyCH4III ACNGT 3 cut(s) 97, 220, 575
HpyCH4V TGCA 7 cut(s) 18, 63, 133, 184, 308, 504, 627
HpyF3I CTNAG 1 cut(s) 35
Hsp92II CATG 6 cut(s) 55, 119, 308, 312, 415, 627
HspAI GCGC 2 cut(s) 6, 468
KpnI GGTACC 1 cut(s) 488
Ksp22I TGATCA 3 cut(s) 112, 118, 271
Kzo9I GATC 6 cut(s) 112, 118, 175, 271, 418, 430
LmnI GCTCC 1 cut(s) 239
LpnPI CCDG 9 cut(s) 164, 167, 177, 178, 216, 306, 327, 564, 608
Lsp1109I GCAGC 4 cut(s) 30, 145, 148, 521
LweI GCATC 1 cut(s) 54
MaeIII GTNAC 3 cut(s) 156, 378, 388
MalI GATC 6 cut(s) 114, 120, 177, 273, 420, 432
MboI GATC 6 cut(s) 112, 118, 175, 271, 418, 430
MboII GAAGA 7 cut(s) 61, 64, 67, 70, 215, 260, 293
MfeI CAATTG 1 cut(s) 340
MflI RGATCY 1 cut(s) 175
MluCI AATT 5 cut(s) 225, 340, 368, 539, 598
MnlI CCTC 4 cut(s) 30, 244, 516, 624
Mph1103I ATGCAT 2 cut(s) 310, 629
MseI TTAA 2 cut(s) 371, 630
MslI CAYNNNNRTG 3 cut(s) 50, 303, 622
MunI CAATTG 1 cut(s) 340
NdeII GATC 6 cut(s) 112, 118, 175, 271, 418, 430
NlaIII CATG 6 cut(s) 55, 119, 308, 312, 415, 627
NlaIV GGNNCC 2 cut(s) 235, 486
NmuCI GTSAC 2 cut(s) 378, 388
NsbI TGCGCA 1 cut(s) 469
NsiI ATGCAT 2 cut(s) 310, 629
NspI RCATGY 2 cut(s) 55, 627
PaeI GCATGC 1 cut(s) 627
PagI TCATGA 2 cut(s) 115, 411
PciI ACATGT 1 cut(s) 51
PfeI GAWTC 1 cut(s) 591
PkrI GCNGC 4 cut(s) 20, 135, 138, 511
PscI ACATGT 1 cut(s) 51
PspN4I GGNNCC 2 cut(s) 235, 486
PstNI CAGNNNCTG 1 cut(s) 326
PsuI RGATCY 1 cut(s) 175
RsaI GTAC 3 cut(s) 56, 222, 486
RsaNI GTAC 3 cut(s) 55, 221, 485
RseI CAYNNNNRTG 3 cut(s) 50, 303, 622
SaqAI TTAA 2 cut(s) 371, 630
SatI GCNGC 4 cut(s) 19, 134, 137, 510
Sau3AI GATC 6 cut(s) 112, 118, 175, 271, 418, 430
ScaI AGTACT 1 cut(s) 222
SetI ASST 9 cut(s) 33, 213, 289, 297, 325, 388, 427, 610, 616
SfaNI GCATC 1 cut(s) 54
SfcI CTRYAG 1 cut(s) 216
SmiMI CAYNNNNRTG 3 cut(s) 50, 303, 622
SphI GCATGC 1 cut(s) 627
Sse9I AATT 5 cut(s) 225, 340, 368, 539, 598
SsiI CCGC 1 cut(s) 107
TaaI ACNGT 3 cut(s) 97, 220, 575
TaqII GACCGA 1 cut(s) 366
TasI AATT 5 cut(s) 225, 340, 368, 539, 598
TatI WGTACW 2 cut(s) 54, 220
TfiI GAWTC 1 cut(s) 591
Tru1I TTAA 2 cut(s) 371, 630
Tru9I TTAA 2 cut(s) 371, 630
TscAI CASTG 2 cut(s) 135, 580
TseFI GTSAC 2 cut(s) 378, 388
TseI GCWGC 4 cut(s) 18, 133, 136, 509
Tsp45I GTSAC 2 cut(s) 378, 388
TspDTI ATGAA 4 cut(s) 287, 293, 400, 411
TspGWI ACGGA 1 cut(s) 226
TspRI CASTG 2 cut(s) 135, 580
XagI CCTNNNNNAGG 1 cut(s) 318
XapI RAATTY 1 cut(s) 598
XceI RCATGY 2 cut(s) 55, 627
ZrmI AGTACT 1 cut(s) 222
Zsp2I ATGCAT 2 cut(s) 310, 629
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.