Rmu_sc0003948.1_g000005

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003948.1
Physical Location & Seq
Forward (+)
23202 .. 23609
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003948.1_g000005.1.cds

Sequence Viewer

Length: 330 bp
atggaggccgaggcattgttggatgggatgttagggaggggtatcaagccgaatgcggtcacgttttgccatttgattctcgggttttgcaaggaggggaatttggagcaagggaagaagatgtttgagaagatggtggagagggggtttgctaaggagagcatggagaagaattgggtgccgaattttgctacgatgaggttgcttgtggatggacttgtgagcattgggaaggtggctgaggctcgccagcttatcggccagatgaaggagaagttcactgtgaatcaacataggtggagtgaagttgaagaaggcttgccacagtga

Protein Analysis

109

Amino Acids

12.33

Weight (kDa)

6.74

Isoelectric Point (pI)

28.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 178
AciI CCGC 1 cut(s) 56
AcoI YGGCCR 1 cut(s) 259
AcsI RAATTY 2 cut(s) 100, 184
AfiI CCNNNNNNNGG 1 cut(s) 268
AgsI TTSAA 1 cut(s) 311
AluBI AGCT 1 cut(s) 253
AluI AGCT 1 cut(s) 253
Ama87I CYCGRG 1 cut(s) 80
AoxI GGCC 2 cut(s) 6, 259
ApoI RAATTY 2 cut(s) 100, 184
AvaI CYCGRG 1 cut(s) 80
BanI GGYRCC 1 cut(s) 178
BbvCI CCTCAGC 1 cut(s) 240
BccI CCATC 3 cut(s) 17, 127, 206
BcgI CGANNNNNNTGC 2 cut(s) 184, 218
BmeT110I CYCGRG 1 cut(s) 80
BmiI GGNNCC 1 cut(s) 180
Bpu10I CCTNAGC 2 cut(s) 153, 240
BsaJI CCNNGG 1 cut(s) 9
BsaXI ACNNNNNCTCC 2 cut(s) 131, 161
Bsc4I CCNNNNNNNGG 1 cut(s) 268
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 3 cut(s) 28, 33, 217
BseLI CCNNNNNNNGG 1 cut(s) 268
BseMII CTCAG 1 cut(s) 231
BshFI GGCC 2 cut(s) 8, 261
BshNI GGYRCC 1 cut(s) 178
BsiHKCI CYCGRG 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 268
BsmI GAATGC 1 cut(s) 58
BsnI GGCC 2 cut(s) 8, 261
BsoBI CYCGRG 1 cut(s) 80
BspACI CCGC 1 cut(s) 56
BspANI GGCC 2 cut(s) 8, 261
BspCNI CTCAG 1 cut(s) 232
BspLI GGNNCC 1 cut(s) 180
BspT107I GGYRCC 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 9
Bst4CI ACNGT 2 cut(s) 283, 327
BstC8I GCNNGC 3 cut(s) 247, 251, 320
BstDEI CTNAG 2 cut(s) 153, 240
BstF5I GGATG 3 cut(s) 28, 33, 217
BsuRI GGCC 2 cut(s) 8, 261
BtsCI GGATG 3 cut(s) 28, 33, 217
BtsIMutI CAGTG 1 cut(s) 279
Cac8I GCNNGC 3 cut(s) 247, 251, 320
CspCI CAANNNNNGTGG 2 cut(s) 278, 313
CviAII CATG 1 cut(s) 163
CviJI RGCY 7 cut(s) 8, 49, 239, 245, 253, 261, 318
CviKI_1 RGCY 7 cut(s) 8, 49, 239, 245, 253, 261, 318
DdeI CTNAG 2 cut(s) 153, 240
EaeI YGGCCR 1 cut(s) 259
Eco88I CYCGRG 1 cut(s) 80
FaeI CATG 1 cut(s) 166
FaiI YATR 2 cut(s) 164, 294
FatI CATG 1 cut(s) 162
FokI GGATG 3 cut(s) 35, 40, 224
HaeIII GGCC 2 cut(s) 8, 261
Hin1II CATG 1 cut(s) 166
HinfI GANTC 2 cut(s) 76, 286
Hpy166II GTNNAC 1 cut(s) 279
Hpy8I GTNNAC 1 cut(s) 279
HpyAV CCTTC 3 cut(s) 226, 262, 308
HpyCH4III ACNGT 2 cut(s) 283, 327
HpyCH4IV ACGT 1 cut(s) 62
HpyCH4V TGCA 1 cut(s) 90
HpyF3I CTNAG 2 cut(s) 153, 240
HpySE526I ACGT 1 cut(s) 62
Hsp92II CATG 1 cut(s) 166
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 2 cut(s) 263, 275
MaeII ACGT 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 58
MboII GAAGA 5 cut(s) 127, 130, 142, 181, 323
MluCI AATT 3 cut(s) 100, 172, 184
MnlI CCTC 6 cut(s) 4, 30, 88, 135, 192, 235
Mva1269I GAATGC 1 cut(s) 58
NlaIII CATG 1 cut(s) 166
NlaIV GGNNCC 1 cut(s) 180
NmeAIII GCCGAG 1 cut(s) 34
NmuCI GTSAC 1 cut(s) 58
PctI GAATGC 1 cut(s) 58
PfeI GAWTC 2 cut(s) 76, 286
PspN4I GGNNCC 1 cut(s) 180
SetI ASST 5 cut(s) 65, 203, 237, 255, 299
Sse9I AATT 3 cut(s) 100, 172, 184
SsiI CCGC 1 cut(s) 56
TaaI ACNGT 2 cut(s) 283, 327
TaiI ACGT 1 cut(s) 65
TasI AATT 3 cut(s) 100, 172, 184
TfiI GAWTC 2 cut(s) 76, 286
TscAI CASTG 1 cut(s) 286
TseFI GTSAC 1 cut(s) 58
Tsp45I GTSAC 1 cut(s) 58
TspDTI ATGAA 1 cut(s) 281
TspRI CASTG 1 cut(s) 286
XapI RAATTY 2 cut(s) 100, 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.